ID: 1130766423

View in Genome Browser
Species Human (GRCh38)
Location 15:86876048-86876070
Sequence CTCTTATTCTTAGTGACAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130766423_1130766424 5 Left 1130766423 15:86876048-86876070 CCTTTTGTCACTAAGAATAAGAG 0: 1
1: 1
2: 0
3: 21
4: 205
Right 1130766424 15:86876076-86876098 AGCCACCTCAAGTTTGATCGAGG 0: 1
1: 0
2: 1
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130766423 Original CRISPR CTCTTATTCTTAGTGACAAA AGG (reversed) Intronic
902167115 1:14581587-14581609 CTCTTATTCTGAGTGAGATGGGG - Intergenic
902267136 1:15275554-15275576 GGCTTCCTCTTAGTGACAAAGGG + Intronic
908641045 1:66223897-66223919 CTCTTTGTCTCCGTGACAAATGG + Intronic
909554294 1:76935996-76936018 TTCTTTCTCTTAGTAACAAATGG - Intronic
910029017 1:82693790-82693812 GTCTTTTTCTTAATGACTAATGG + Intergenic
911542530 1:99175320-99175342 TTCTTCTTCTTAGGGACAGAAGG + Intergenic
913341301 1:117760316-117760338 TTTTTTTTCTTTGTGACAAAAGG - Intergenic
914891121 1:151624321-151624343 TTTTTATTCTTGGTGACAAGTGG + Intronic
915058060 1:153155056-153155078 CTCTTCTTCTAAATGCCAAATGG + Intergenic
917488394 1:175476137-175476159 CTCTTATTCTCAATGCCCAAGGG - Intronic
918193117 1:182195526-182195548 CTCTTGTTTATAGTAACAAATGG + Intergenic
918662343 1:187105381-187105403 CTCTTGCTCATAGTAACAAAGGG - Intergenic
920698104 1:208197264-208197286 TTATTATTCTAAGTGATAAAGGG + Intronic
921417115 1:214901587-214901609 CTATTATCCTTAGTTTCAAAGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923760847 1:236842736-236842758 TTTATATTCTTAGGGACAAAGGG + Intronic
923940474 1:238818092-238818114 CTCTTTTTCTTATTTTCAAAAGG + Intergenic
924526340 1:244854079-244854101 CTGTTATTCTCTGTGAGAAATGG + Exonic
1064800246 10:19062681-19062703 CTCTAATTCATAGAGACAGAAGG + Intronic
1065605075 10:27409925-27409947 CTCTTTTTCTTCGTGACACTAGG - Intronic
1074665936 10:115724225-115724247 TTATCATTCTTAGTCACAAATGG + Intronic
1075232566 10:120693672-120693694 CACTTATTCTTACTTACAAGTGG - Intergenic
1077424541 11:2468176-2468198 CTCTTAGCCTAAGTGACAGAGGG - Intronic
1078970727 11:16408003-16408025 CTGTTATTCTTATTTATAAAAGG - Intronic
1079484791 11:20924347-20924369 CTCTTATTATTACAGACAATAGG + Intronic
1080716106 11:34801610-34801632 CTCTTATTAGTAGTGGGAAAAGG + Intergenic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081285520 11:41264498-41264520 CTCTCATTCTAACTGAAAAATGG - Intronic
1083462326 11:62822394-62822416 CTTTTACTCTGAGTGACATAGGG - Intronic
1086100989 11:83099622-83099644 CTCTTATTCTTGGTCTCAGAAGG - Intergenic
1086882402 11:92164710-92164732 CTCTTGTTCTTAGTAAAACAAGG - Intergenic
1086944890 11:92835200-92835222 CTCCTATTCTTGGGGACAAATGG - Intronic
1090606872 11:128430809-128430831 CACTTATACTCAGTGTCAAATGG + Intergenic
1091361335 11:134980800-134980822 CTCTTCTTCTTACTTCCAAAAGG - Intergenic
1092404202 12:8206136-8206158 GTTTTATTCTAAGAGACAAACGG - Intergenic
1092687785 12:11070949-11070971 CTCTTTTTCTTAGAAAAAAATGG - Intronic
1093158282 12:15714648-15714670 TTTTTATTCTAAGTGAGAAATGG - Intronic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093603029 12:21053583-21053605 ATATTATTCTTAGTGAAAAAAGG + Intronic
1095148555 12:38762509-38762531 CTCATATTCTTAGGGACCTATGG - Intronic
1100505904 12:95219738-95219760 CTCTTATTCTTAATGGAAACCGG - Intronic
1100988985 12:100232005-100232027 ATCATATTCTTTCTGACAAAAGG + Intronic
1101210590 12:102531673-102531695 ATCTTATTTTGAGTGAGAAAGGG + Intergenic
1104526882 12:129532409-129532431 CTATTAATATTAGGGACAAAAGG + Intronic
1107037395 13:35915931-35915953 CTCTTATTCTTCTTTGCAAACGG - Intronic
1109186725 13:59278083-59278105 CTCTATTTCTTACTGAGAAATGG - Intergenic
1110774397 13:79390872-79390894 CTCTTATTTTTGGTGATGAAAGG - Intronic
1110925660 13:81148156-81148178 CATTTATTCTTCCTGACAAAGGG + Intergenic
1111629355 13:90829249-90829271 CTTTTGTTTTTAGTGACATAAGG + Intergenic
1112491623 13:99870654-99870676 CTCTTATTTTTAGTTACAGGTGG - Intronic
1114671470 14:24413844-24413866 CTCTTATTCTTTGTATCCAAGGG + Intronic
1115107022 14:29773840-29773862 CGCTTATTTTTATTAACAAATGG - Intronic
1115529426 14:34313554-34313576 TTCTTATTCTTCGTGACTGATGG + Intronic
1115673260 14:35640344-35640366 CTTTTTTTCTTAGTGGCCAAAGG - Intronic
1116870648 14:50066531-50066553 GTCCTATGCTTAGTGAGAAATGG + Intergenic
1118100646 14:62597641-62597663 CTCTTTTTCTAAATGCCAAAAGG - Intergenic
1121095059 14:91212285-91212307 CTCAAATTCCTAGTGTCAAATGG - Intronic
1121804175 14:96800387-96800409 CTCCTGTTCTGAGTGACATATGG + Intronic
1130602464 15:85285668-85285690 GTCTTATTCTTAGTGACAAAAGG + Intergenic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1131736510 15:95338455-95338477 GTGCTATGCTTAGTGACAAAAGG - Intergenic
1134280783 16:12815018-12815040 TTCTTATTCTTGTTGAAAAAGGG - Intergenic
1134745417 16:16584400-16584422 CTGTTCTTCTTAGTGAAGAAAGG - Intergenic
1140089627 16:71827040-71827062 CTATTATTCTAAGTGAAATATGG + Intergenic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148113304 17:45159929-45159951 GTCTTATTATCAGTTACAAATGG - Intergenic
1149102743 17:52925822-52925844 CTTTTTTTCATAGTGAGAAAAGG - Intergenic
1149692944 17:58593456-58593478 TTCTTATGTCTAGTGACAAAAGG - Intronic
1150030602 17:61730573-61730595 ATCTTATTTTTGGTGAGAAAAGG - Intronic
1154493965 18:14942124-14942146 CTCTTCTTCTTACTTCCAAAAGG + Intergenic
1156559986 18:38113557-38113579 CTGTTATTCTAAGTGAAAGAAGG + Intergenic
1156827550 18:41449890-41449912 CTCTTATTGTTATTGATTAATGG - Intergenic
1157235477 18:45961302-45961324 CTTTTACTCTGAGTGACATATGG - Intronic
1157240978 18:46009092-46009114 CTCTCATGCTTAGTGAGAGAAGG + Intronic
1159141784 18:64405194-64405216 CTCTTATTCTCAGGTACAAATGG + Intergenic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1160083744 18:75754569-75754591 CTTTTCCTCTTAGTGACACAGGG + Intergenic
1160536742 18:79598461-79598483 CTCTCGTTCTCAGAGACAAAGGG - Intergenic
1161183792 19:2902343-2902365 TTCTTCTCCTTAGTGACAATAGG + Intronic
930605409 2:53488041-53488063 CTCTGACTCTTAGTGACAACAGG - Intergenic
931115031 2:59156278-59156300 CTGGTTTTCTTAGTTACAAACGG - Intergenic
931794291 2:65694515-65694537 CTATTATTCTTCATGACAAGTGG + Intergenic
932327196 2:70871226-70871248 CTCTTCCTCTTAGTGACTAGAGG - Intergenic
933491523 2:82991086-82991108 TTCTTATGCTTAGTAACAAAAGG + Intergenic
935140821 2:100351386-100351408 CTCTTGTTATCAGTGAGAAAGGG + Intergenic
935805808 2:106746534-106746556 TTCTTTTTCTTTGTGCCAAATGG + Intergenic
936724114 2:115291654-115291676 ATTTCATTCTTAGTGATAAATGG - Intronic
937614570 2:123906547-123906569 CTCTTGTCCTTAGTTCCAAAAGG - Intergenic
939158205 2:138551295-138551317 CTATTTTTCTAAGTGACAACTGG - Intronic
939408318 2:141789409-141789431 CTCTTATTTTTCTTGACAAGTGG - Intronic
939728258 2:145750616-145750638 CTCTTATTTTTACTGGCAGAGGG - Intergenic
940218579 2:151326822-151326844 ATTTTATTATTAGTGAAAAATGG - Intergenic
943389207 2:187242204-187242226 CACATATTATTAGAGACAAAAGG - Intergenic
944290169 2:197995871-197995893 CTTTCTGTCTTAGTGACAAATGG + Intronic
945052758 2:205840724-205840746 GTCTTGTTCTTAGTCTCAAAGGG - Intergenic
945203169 2:207305237-207305259 CTCTTGTGCTTTGTGAGAAATGG - Intergenic
945671355 2:212806138-212806160 CTTTTTTTCTTAGTGGCAGAAGG - Intergenic
947759359 2:232592518-232592540 GTCTTTTTCTTATTGACTAACGG + Intergenic
1168781361 20:493870-493892 ATCTCATGCTTAGTGAAAAAAGG - Intronic
1177693767 21:24545149-24545171 CTTTTATTTTTAGTGACAATGGG + Intergenic
1177866573 21:26519577-26519599 CTCTTACTCTGTGTGAAAAAGGG + Intronic
1178189400 21:30263335-30263357 CTCTTTTTCTTGGTGGCATAAGG + Intergenic
1178196979 21:30356914-30356936 CACTTTTTATTAGTGTCAAAGGG + Intronic
1179884520 21:44307852-44307874 TTCTTCTTCTAAGTGGCAAAGGG + Intronic
1183373382 22:37448361-37448383 CTATTACTCTATGTGACAAAGGG - Intergenic
1184107589 22:42377198-42377220 CACCTGTTCTTAGTGAAAAAGGG - Intergenic
949496533 3:4637570-4637592 CTGCTATTCTCAGTGACACAAGG - Intronic
949528208 3:4927365-4927387 CTTTCATTTTTAATGACAAAAGG + Intergenic
952340168 3:32438843-32438865 CTCTTTTTCATGGTGACACAGGG - Intronic
952902330 3:38118485-38118507 GACTTATTCTCAGTGACAATTGG + Intronic
954905578 3:54059638-54059660 CCCTTTTTCTCAGTGAGAAAGGG + Intergenic
955077638 3:55629006-55629028 CTCTGCTTCTTAGTCCCAAATGG - Intronic
956567213 3:70652325-70652347 CCCTCTTTCTTAGGGACAAAAGG - Intergenic
958171853 3:89948293-89948315 CTCTTAGTCTTAGGGGAAAAGGG + Intergenic
959159829 3:102709743-102709765 CACATATTCTTATTTACAAAAGG - Intergenic
959347389 3:105215901-105215923 AGTTTATTCTTAGTTACAAAAGG + Intergenic
962085531 3:132187633-132187655 CTCTTATTATTAATGAAAAGGGG + Intronic
963464867 3:145666470-145666492 CTCTAATTCTTCATGACAGAGGG - Intergenic
964272212 3:154968904-154968926 CTCTTATTCTAAGTGATACTTGG + Intergenic
965011142 3:163093620-163093642 CTTTTATTCATAGTGAAAAAGGG - Intergenic
970732296 4:19120466-19120488 CACAAATTCTTAGTGACAACAGG - Intergenic
971270654 4:25141722-25141744 CTCATATTCTGAGTGAAATAGGG - Intronic
971615879 4:28790008-28790030 CTGGTTTTCTTTGTGACAAAAGG + Intergenic
972657052 4:41074451-41074473 CTCTTTATCATAGTGACAACAGG + Intronic
973534805 4:51870418-51870440 CTGTTTGTTTTAGTGACAAATGG + Intronic
973644064 4:52932656-52932678 CTCTTCTTCTAAGAAACAAAGGG - Intronic
974832556 4:67207361-67207383 GTCTTATTATTATTCACAAATGG + Intergenic
977432168 4:96943909-96943931 GTTTTATTCTTTGTGACCAAAGG - Intergenic
977626050 4:99190816-99190838 CCCTTATTATTAGTGTGAAAAGG + Intergenic
978708618 4:111748595-111748617 CTCTTCTGCCTAGTGACAGATGG + Intergenic
978714955 4:111830932-111830954 CTCTTATTCTTATTGTATAAAGG - Intergenic
979788305 4:124745353-124745375 CTATTTTTCTAAGTGACAAAAGG - Intergenic
979914730 4:126416594-126416616 TTCTTATTAATAGTGTCAAAGGG + Intergenic
980117025 4:128689080-128689102 CTCTTTTTCTTGGTGTGAAAGGG + Intergenic
980492220 4:133542913-133542935 CTCTCATTCTTGGTGAAAACAGG - Intergenic
981492154 4:145351043-145351065 CTCTTATTCTTTTTAAAAAATGG - Intergenic
981994018 4:150957124-150957146 CCCTGATTTTTAGTGAGAAATGG - Intronic
983691840 4:170480605-170480627 GGCTTATTCTGAGTGACCAAGGG + Intergenic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984371325 4:178870008-178870030 CTAATATTCTGAGTGACAGAGGG + Intergenic
984687608 4:182689079-182689101 ATTTTAATTTTAGTGACAAATGG - Intronic
984962029 4:185107031-185107053 CTTTTATTCTTAATGCCAACAGG + Intergenic
985879235 5:2626028-2626050 CTGTGAGTCTTAGAGACAAAGGG + Intergenic
986550156 5:8944598-8944620 TTCTTATACTTATTGTCAAATGG - Intergenic
986559504 5:9046481-9046503 CTCTAATACTTGGTGTCAAAGGG + Intronic
987074325 5:14366631-14366653 CTGTTATTTTTAGTAGCAAATGG - Intronic
987988312 5:25178891-25178913 ATATTATTCTTAGTGCCACATGG - Intergenic
989559958 5:42838715-42838737 CCCTCATTTTTAGTGATAAATGG - Intronic
995523668 5:113033841-113033863 TTCTTATTCCTGGTGATAAAAGG + Intronic
996038450 5:118784266-118784288 ATGTGATTCTTAGAGACAAATGG + Intergenic
996600843 5:125261592-125261614 GACTTATTTTTAGTTACAAAAGG - Intergenic
996869381 5:128170467-128170489 TTATTACTCTTACTGACAAATGG - Intronic
997889109 5:137659352-137659374 CTTTCATTCCTAGTGACAGATGG - Intronic
1004357104 6:14939422-14939444 CTCAAATTCTTTGTGAAAAATGG - Intergenic
1005655442 6:27930685-27930707 TTCTTATTCTTTATGAAAAATGG + Intergenic
1007141100 6:39575575-39575597 CTCTTATTTTTCGTGAGAATAGG + Intronic
1007252780 6:40507544-40507566 CTCTTAACCTCAGTGCCAAAGGG + Intronic
1010860870 6:80909341-80909363 GTCTTATTCTGGGTAACAAAAGG + Intergenic
1011667038 6:89644318-89644340 CTCTTTTACTTAGTAATAAAAGG - Intronic
1012035342 6:94130566-94130588 TGCTTATTCTTAGTGAGAAAGGG - Intergenic
1012376846 6:98572252-98572274 CTCTTATTCTTAGATATACATGG + Intergenic
1012905117 6:105055320-105055342 CTGTTATTCATAGTGACACGAGG - Intronic
1013135856 6:107282237-107282259 CTATCATTCTTAGTTTCAAAAGG + Intronic
1013755601 6:113457994-113458016 CTCTTTTTCTTTGTGACCAGTGG - Intergenic
1014863950 6:126505539-126505561 CTTTTATTATTAGTGTGAAAAGG - Intergenic
1015303041 6:131675921-131675943 CTTTTACTCTGAGTGACACAGGG - Intronic
1020582492 7:10021628-10021650 CTGTTACCCTTGGTGACAAAGGG + Intergenic
1021211899 7:17863829-17863851 CTCTTTCTCTTAATTACAAAGGG - Intronic
1022250699 7:28605033-28605055 CTCTTTTTTTTAATGAGAAAGGG - Intronic
1022323686 7:29310489-29310511 GTTTTATTCTTAGTGCCCAACGG + Intronic
1022524778 7:31029808-31029830 CTTTTATTCTAATTCACAAAAGG - Intergenic
1023568238 7:41545659-41545681 TTATTATTCTTATTGACATATGG + Intergenic
1024834984 7:53506402-53506424 CTGTTATTCTCTGTGAGAAATGG - Intergenic
1024867290 7:53918723-53918745 CTCTTGCTCTTAATAACAAATGG - Intergenic
1027644126 7:80775274-80775296 CTCTTTTTGTTAGTGCCAACTGG + Intronic
1027682167 7:81234395-81234417 CAAATATTCTTAGTAACAAATGG + Intergenic
1028014660 7:85691992-85692014 CACCAATTCTTAGTGAAAAAAGG + Intergenic
1029811119 7:103050232-103050254 CTCTTTTTCTTTGTGCAAAATGG - Intronic
1030160096 7:106498855-106498877 TTCTTATTTTTTGTGAAAAAAGG + Intergenic
1031632718 7:124063862-124063884 CCCTTAGTCTTAGATACAAATGG - Intergenic
1032554484 7:132817445-132817467 CTATTCTCCTTAGGGACAAAAGG + Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1034781381 7:153885992-153886014 CTCTTATTCTTTTTTACAAACGG + Intergenic
1042151607 8:65792161-65792183 CTCATATCCTTAGTGAAACATGG + Intronic
1042283926 8:67086743-67086765 CTCTTATTCTGATTTACACATGG + Intronic
1043268425 8:78297535-78297557 ATCTGATCCTTAGTGACAAATGG - Intergenic
1043296976 8:78677689-78677711 TTCTTATTCTTAGTGTTACAGGG + Intronic
1043745869 8:83872677-83872699 CTTTTACTCTGAGTGACAATGGG - Intergenic
1043809631 8:84721066-84721088 ATCTTATTTTTAGTCTCAAAAGG - Intronic
1043859685 8:85301719-85301741 CACTTATTTTTAGTGACAACAGG + Intergenic
1043866960 8:85385781-85385803 TTTTTATTTTTGGTGACAAATGG - Intronic
1044112696 8:88295889-88295911 CACTTATTGTTAGAGAAAAATGG - Intronic
1045230530 8:100302120-100302142 CTTTTATTCTAAGTGAGACAGGG + Intronic
1046101101 8:109615050-109615072 CTCTTTATCTTAATGACCAAAGG + Intronic
1046672932 8:117077254-117077276 CTCTAGCTCATAGTGACAAAGGG + Intronic
1047706555 8:127505266-127505288 CTCTTTTTCTTTATGACAGAGGG - Intergenic
1048784541 8:138036626-138036648 ATCTTATTCTTGGGAACAAAGGG - Intergenic
1050760269 9:9060718-9060740 CTCTGATTATTAATGAGAAAAGG + Intronic
1051194692 9:14551017-14551039 CTTTTATACTTAGGGAAAAAAGG + Intergenic
1051675677 9:19555973-19555995 ATGTTATTCTAAGTGACAACTGG + Intronic
1053569025 9:39284894-39284916 CTCTTAATTTTAGTGTCAAATGG - Intronic
1053834988 9:42125941-42125963 CTCTTAATTTTAGTGTCAAATGG - Intronic
1054090658 9:60843871-60843893 CTCTTAATTTTAGTGTCAAATGG - Intergenic
1054112069 9:61119428-61119450 CTCTTAATTTTAGTGTCAAATGG - Intergenic
1054128119 9:61334113-61334135 CTCTTAATTTTAGTGTCAAATGG + Intergenic
1054595544 9:67061588-67061610 CTCTTAATTTTAGTGTCAAATGG + Intergenic
1055399968 9:75912847-75912869 CTCTTTTTGTAAATGACAAAGGG + Intronic
1055607368 9:77984810-77984832 CACTTATTATAACTGACAAAGGG + Intronic
1055996014 9:82160987-82161009 CTTTTATTCTTAGTGAGATGAGG - Intergenic
1056450663 9:86713707-86713729 CTTTCATTCTTAGTCACAAATGG - Intergenic
1058165019 9:101609385-101609407 CTCTTATTCTTAGAACAAAATGG + Intronic
1186040959 X:5477823-5477845 CACTTATTATTAGTTCCAAATGG + Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1186397884 X:9228237-9228259 CTCTTGTTCTTATTCCCAAAAGG + Intergenic
1188347694 X:29087497-29087519 CTGTTATTATTAGAGACCAAGGG + Intronic
1188693876 X:33163699-33163721 CTCTTACTCATAGTGATAAGGGG + Intronic
1189903893 X:45737186-45737208 GTCTTATTCTCAGTCTCAAAGGG - Intergenic
1190680428 X:52822268-52822290 CTCTTACTTTTAGAAACAAATGG - Intergenic
1190977799 X:55424053-55424075 CACATATTCTCAGTGATAAATGG + Intergenic
1191011211 X:55761388-55761410 CTCTTATTTTTATTAACAAATGG - Intergenic
1191035570 X:56022887-56022909 CTCTGATTATTTCTGACAAATGG - Intergenic
1193471476 X:81909063-81909085 CTCTCACTCTTAGAGAAAAAAGG - Intergenic
1195706283 X:107740225-107740247 CTCATATGCTTAGTCACAAGTGG - Intronic
1195803937 X:108741823-108741845 GTATTTTTCTTAGTGTCAAAAGG + Intergenic
1197361351 X:125507357-125507379 CTCTAATACTAAGTGACTAATGG - Intergenic
1200681564 Y:6218553-6218575 CTCTGATGATTAGTGACAATGGG + Intergenic
1201541037 Y:15105008-15105030 CTCATATTCTCAGTTGCAAATGG - Intergenic
1201546782 Y:15173956-15173978 CACTTATTATTAGTTCCAAATGG - Intergenic