ID: 1130767931

View in Genome Browser
Species Human (GRCh38)
Location 15:86891695-86891717
Sequence CCTTCTCTACTCAAGTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130767925_1130767931 21 Left 1130767925 15:86891651-86891673 CCATCATTCATTGGTAAAGTGAA 0: 1
1: 0
2: 1
3: 17
4: 235
Right 1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG 0: 1
1: 0
2: 0
3: 8
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130767931 Original CRISPR CCTTCTCTACTCAAGTGACA TGG Intronic
900795147 1:4703314-4703336 CCCCCTCTACTCAGGGGACATGG - Intronic
906472423 1:46142300-46142322 CCTTTTCTAGTTAGGTGACAGGG + Intronic
907230812 1:52996674-52996696 CCTTCTCTAATCAGGGGAAAGGG - Intronic
907387507 1:54135725-54135747 CCTTCTCTTCTCAGGTCAAAAGG + Intronic
907440798 1:54476835-54476857 CCTTCCCTACTCATGCAACATGG + Intergenic
909950073 1:81708569-81708591 CCTTCTCTTCTGAAGTGCCAAGG - Intronic
911367661 1:96958538-96958560 AGTTTTCTCCTCAAGTGACATGG - Intergenic
922135596 1:222822230-222822252 CCTTCTGAACACAAGTGAAATGG - Intergenic
924117032 1:240757971-240757993 CCGTCTCTACTAAAGGTACAAGG - Intergenic
924535302 1:244930744-244930766 CCTTCACTCCTCAGGTAACAAGG + Intergenic
924761938 1:246995657-246995679 CCGTCTCTACTAAAAAGACACGG + Intronic
1065170572 10:23023014-23023036 CCTTCTCTCACCAAGAGACATGG + Intronic
1065364136 10:24918359-24918381 CATTCTCCACTAAAATGACATGG - Intronic
1069250115 10:66256874-66256896 CCTTTTCTACTCTAGTGTCCTGG - Intronic
1070232650 10:74586212-74586234 CCTTCTCTAATGGAGTGACTTGG + Intronic
1072041181 10:91608411-91608433 CCTGCTCTACTCCAGGGCCAGGG - Intergenic
1074855678 10:117471736-117471758 CCATCACAACACAAGTGACATGG - Intergenic
1078517054 11:12031799-12031821 CCTGCTCTCCTCCAGAGACAAGG - Intergenic
1078680616 11:13472311-13472333 CATTCTCTACTCCAGTGTCCTGG - Intergenic
1085131888 11:74047146-74047168 CCTGCCCTGCTCAAGGGACAGGG - Intronic
1085430762 11:76445593-76445615 CCTTCCCCACTCAAGTGTCAAGG - Intronic
1086845943 11:91749597-91749619 CTTTCTCTACTACAGTGGCATGG + Intergenic
1087440438 11:98176963-98176985 CCTTCTAAACTCCAGTGATATGG + Intergenic
1088033078 11:105276017-105276039 TCTTCTCTACTTAACTCACAGGG - Intergenic
1093197514 12:16146229-16146251 CCTGCCCCACTCATGTGACAAGG - Intergenic
1093211453 12:16313967-16313989 ACTTGTCTACTCAAATGTCAAGG - Intergenic
1094446143 12:30532677-30532699 CCATTGCTACTCAAGTCACAAGG + Intergenic
1095254955 12:40023689-40023711 ACTTCTCATCTCTAGTGACATGG + Intronic
1095587025 12:43860775-43860797 CCTTCTCTCCTTAAGTAAAAGGG + Intronic
1098407391 12:70140708-70140730 CATTCTCTACTCCAGTGTCCTGG + Intergenic
1100000309 12:89826717-89826739 CCTCCTCTATTCTAATGACATGG + Intergenic
1101882292 12:108633792-108633814 GCTTCTCTGCTTTAGTGACAAGG + Intronic
1102296554 12:111741369-111741391 CCTGCTCTGCTCCAGTGACCTGG + Intronic
1106797178 13:33218513-33218535 CCATCTCTACTGAAGTGAATAGG + Intronic
1108551016 13:51544311-51544333 CTTTCTCTCCTCAAGTGAAATGG - Intergenic
1109327494 13:60885976-60885998 CCTTTTCTATACAATTGACAAGG + Intergenic
1114622295 14:24103455-24103477 CCTTCCCTACCCCAGTGAGAAGG + Intronic
1115453027 14:33570609-33570631 ACTTGTCTGCTCAAGTGAAAAGG - Intronic
1118952862 14:70450178-70450200 CCTTCTCCACCCAAATGTCATGG - Intergenic
1119911562 14:78354320-78354342 ACTTCTCTCATCAAGAGACAGGG - Intronic
1119958393 14:78825888-78825910 CCTCCTCTACCAAAGTCACAGGG + Intronic
1120777312 14:88452032-88452054 CATTCTCTACCCAAATGAGAAGG - Intronic
1121438399 14:93933655-93933677 CCTGCTCTACTCAATCCACAGGG + Intergenic
1121685195 14:95830544-95830566 TCTTCCCTTCTCTAGTGACAGGG - Intergenic
1124079729 15:26480549-26480571 CCTTCTCTAGGCATGTTACATGG - Intergenic
1129613587 15:77081275-77081297 CCTTCTCCCCTCAGGTTACAGGG - Intronic
1130336789 15:82963392-82963414 CCATCTCTTCTGAAATGACATGG + Intronic
1130767931 15:86891695-86891717 CCTTCTCTACTCAAGTGACATGG + Intronic
1134036959 16:11038441-11038463 CCTTATCTGCTCAACTGACGTGG - Intronic
1134754948 16:16658774-16658796 CCATCTCTACTAAAGAGACTAGG + Intergenic
1134991115 16:18700375-18700397 CCATCTCTACTAAAGAGACTAGG - Intergenic
1135619821 16:23946161-23946183 CCTTCTCTACTCACTTCACTGGG + Intronic
1135990659 16:27216775-27216797 CCTTCACTTAGCAAGTGACATGG - Intronic
1136997780 16:35202586-35202608 GCTTCACTACTCAAGGAACAGGG - Intergenic
1137904129 16:52301732-52301754 CCTACTCTAATCATGTGACATGG - Intergenic
1141164830 16:81653366-81653388 CCTTCTCTACTCCACAGACACGG - Intronic
1145046046 17:19617117-19617139 CCTTGTGAACTCAAGTCACATGG - Intergenic
1148438642 17:47700543-47700565 CATTTTCTATTCCAGTGACAAGG + Intronic
1149140802 17:53430222-53430244 CCTTTACTGCTCAGGTGACATGG + Intergenic
1149210437 17:54294381-54294403 CCTTCTCTACTCTAGGAAGAAGG - Intergenic
1149694454 17:58605601-58605623 CCCACTCCACTCAAGTCACAGGG + Intronic
1154097038 18:11427694-11427716 CCTTCTCAACTCACCTTACAAGG - Intergenic
1154302539 18:13207102-13207124 ACTGCTTTACTCAAGGGACAGGG - Intergenic
1155869270 18:31005565-31005587 CCTTCTAAACTCTAATGACATGG + Intronic
1156122117 18:33858041-33858063 CCATCTCAACTCAAGAGGCAAGG + Intronic
1156845491 18:41661207-41661229 CCTTCTCTGCCCAGATGACAAGG - Intergenic
1157045664 18:44099524-44099546 CCTTCTATACGCATGTGATATGG + Intergenic
1158618608 18:59010681-59010703 CACTCTCTACACAAGTGACCCGG + Intergenic
1159920240 18:74221254-74221276 CCTTCCCTGCTCAGGTGAGAAGG + Intergenic
1166246509 19:41530992-41531014 CCTTATCTTCTCACCTGACAAGG - Intergenic
1167006828 19:46781733-46781755 CCTTCTCTGCACAAGTGGCTGGG - Intronic
1168049500 19:53818242-53818264 CCTTCTCTACAAAATTGACCAGG - Intronic
925502593 2:4522668-4522690 CCCTCTCCACTTCAGTGACACGG + Intergenic
930862413 2:56088618-56088640 ACTTGTTCACTCAAGTGACACGG - Intergenic
940063412 2:149598254-149598276 CCTGCACTGCTCAAATGACAGGG - Intergenic
940499946 2:154481222-154481244 CTTTCTCTACTACAGTGCCATGG + Intergenic
942152599 2:173092090-173092112 CCTTCTCTAATCAATTGCTATGG - Intronic
946558922 2:220890833-220890855 CCTTCTCTTCTCAACTGAATTGG - Intergenic
947369918 2:229434788-229434810 ACTTGCCTACTCAAGTGATAAGG - Intronic
1169677092 20:8166477-8166499 CCTTCTCTACTCACATGTTAGGG + Intronic
1174162422 20:48561057-48561079 TCTTCTCTTCCCCAGTGACAGGG - Intergenic
1174743745 20:53040985-53041007 CCCTCTCTTCTCAGGTGCCAAGG + Intronic
1175324549 20:58113829-58113851 CCTCCTCCCCTTAAGTGACATGG + Intergenic
1175904149 20:62371580-62371602 CCTTTTCTTCCCAAGTGGCAAGG + Intergenic
1177127836 21:17217682-17217704 CATAGTCTACCCAAGTGACAAGG + Intergenic
1178802559 21:35809693-35809715 CCTTCTGGTCTCAAGTTACAAGG - Intronic
1182886834 22:33781134-33781156 CCTGCTCTCTTCAAGTGACGTGG - Intronic
1183076788 22:35432479-35432501 CCTGCTCTGCTCTACTGACAAGG - Intergenic
952899745 3:38102163-38102185 CCTTCTCTCCCCTATTGACAAGG + Intronic
955606304 3:60708585-60708607 ACTTCTCTACTCAAGCCACCAGG - Intronic
955691111 3:61591573-61591595 CCTTCTCTAGGCCAGTGGCATGG + Intronic
956806371 3:72817232-72817254 TCTTCTCTCCTTCAGTGACACGG + Exonic
960864568 3:122185882-122185904 TCTTCTCTACTCAAGGGTCTTGG - Intronic
961066013 3:123878239-123878261 CCTTCTCTACTCATCTGATGAGG - Intronic
961605034 3:128087280-128087302 CCTTTTCTACTCAGAGGACAAGG - Intronic
962021898 3:131510616-131510638 CCCTCTCTACTCAAGGCAGATGG - Intergenic
966881209 3:184352322-184352344 CCCTCTCTACTAGAGTGACGCGG - Exonic
968243283 3:197113149-197113171 CCTTCTCTATTGAACTGACTTGG + Intronic
969259651 4:6025335-6025357 CCTTCTGTACCCAAGTGTCTGGG - Intergenic
969844991 4:9913611-9913633 CCCTCTCAACCCAAGGGACAGGG + Intronic
971396138 4:26229251-26229273 GCTTCTCAACTCAACTGAGAAGG - Intronic
971828610 4:31660909-31660931 CCTTCTGAATTCAAGAGACATGG + Intergenic
976587349 4:86813595-86813617 CCATCTCTACTAAAGTGAGGTGG - Intronic
978109135 4:104941314-104941336 CAGGCTCTACTCAAGTGATAGGG + Intergenic
980158602 4:129134286-129134308 CCTTCTTAACTCATGTGAGATGG + Intergenic
981113398 4:140960695-140960717 CCATCTTTACTCAAGAGTCAGGG - Intronic
982796560 4:159653254-159653276 CCTTCTGAATTGAAGTGACAGGG - Intergenic
984206056 4:176789255-176789277 CTTTCTCAACTCAACTGAAAAGG + Intronic
984810872 4:183795923-183795945 CCTTCACCAGTCCAGTGACAGGG + Intergenic
986039724 5:3980886-3980908 GCTTCTCTACCCAAGAAACAAGG - Intergenic
986352841 5:6896050-6896072 CCTGCTCTACTCAAGGCTCAGGG - Intergenic
988658375 5:33237424-33237446 CTTTCTCTACTGCAGTGCCATGG - Intergenic
992583321 5:78204771-78204793 CCTTCTCTGCCTCAGTGACAGGG - Intronic
994664952 5:102695064-102695086 CATTCTCTACTCCAGTGTCCTGG - Intergenic
997012928 5:129900833-129900855 CCTTCTATTCTCAAGTGATGAGG + Intergenic
997966171 5:138358151-138358173 CCATCTCTACTAAAATTACATGG - Intronic
998136965 5:139678998-139679020 CCTGCTCTACTCAGGTTTCAAGG - Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999536731 5:152525641-152525663 CCTTCTCTACTAAAATCACAGGG + Intergenic
1000592351 5:163173629-163173651 GCTTCTCTATGCAAGTGCCAAGG + Intergenic
1002994006 6:2265511-2265533 CCTTCTCTAATGAAATGACTCGG - Intergenic
1003639995 6:7868581-7868603 CCTTCTCTCCTAGAATGACAAGG - Intronic
1003708473 6:8562107-8562129 CCTCCTCTACTCCAGCCACATGG + Intergenic
1004975855 6:20965298-20965320 TCTTCTCTTCTCAAGATACAGGG - Intronic
1007768641 6:44176566-44176588 CCATCTCTGCTCCAGTGCCAGGG + Exonic
1008389076 6:50928432-50928454 CTTTCTCTACTCTATTGCCAAGG + Intergenic
1010047547 6:71464114-71464136 CTTTCTCAAGTCAAGGGACAGGG - Intergenic
1011344296 6:86352209-86352231 TATTCACTACTCATGTGACATGG - Intergenic
1012301569 6:97595061-97595083 GCATCTCTCCTCAAGTTACATGG + Intergenic
1015242080 6:131035926-131035948 CCTTCTCTAATCAACTTAGAGGG - Intronic
1022965294 7:35466509-35466531 CCTTCTCTTCTCAAATGGGATGG + Intergenic
1026063393 7:67046871-67046893 CTTTCTCTAGTGAAGGGACAGGG + Intronic
1033405873 7:141071728-141071750 CCTGCTCTGCTCACGTGAGACGG - Intergenic
1036097549 8:5740878-5740900 CCTCTTCTACTGAAGTGGCATGG + Intergenic
1036932884 8:12973342-12973364 CATCCTCAAGTCAAGTGACAGGG + Intronic
1039483364 8:37892354-37892376 CATTCTCTACCCAAGAGCCACGG + Intronic
1039785545 8:40831526-40831548 GCTTCTCTCCTCAAGGGACTGGG - Intronic
1039982158 8:42416896-42416918 CATTCTCTACTCTGATGACAAGG + Exonic
1041181130 8:55249372-55249394 CTTTATCTACTCAAGTTACAAGG + Intronic
1041963355 8:63646311-63646333 TCTTCACTTCCCAAGTGACAGGG + Intergenic
1042294354 8:67203503-67203525 CCTTCTCTTCTCAACTGCTATGG + Intronic
1045946536 8:107802622-107802644 CCTTCCCTATTCAAGGGACATGG - Intergenic
1047619020 8:126587480-126587502 TCTTCTACACTCAAGTGCCATGG + Intergenic
1049118486 8:140711470-140711492 CATTCTGTGTTCAAGTGACAGGG - Intronic
1049850731 8:144828879-144828901 CCTCCTTCACTCAAGTGCCATGG + Intronic
1051904660 9:22081492-22081514 TCTTCTCTACTCCAGAGACTTGG + Intergenic
1052127607 9:24797198-24797220 CCTTCTGTTCTCAAGTAATATGG - Intergenic
1054966930 9:71039554-71039576 CCTTCTCTACTTTTGTGAGAAGG - Intronic
1055166880 9:73207613-73207635 CCCTCTCTAAATAAGTGACATGG - Intergenic
1055469617 9:76598284-76598306 CCATCTCTACTAAAAGGACAAGG + Intergenic
1055641406 9:78321294-78321316 TCCTCTCTACTCCAGTAACAAGG - Intronic
1056238420 9:84619083-84619105 CCTTCTCTGCTCTGGGGACAAGG + Intergenic
1056707192 9:88961175-88961197 CCTGCTGTAATCAAGTGAAAAGG + Intergenic
1057503116 9:95611416-95611438 CCTTCTCAACTCATTAGACATGG + Intergenic
1057724707 9:97560111-97560133 CCATATCTAATCAAGTGACTTGG + Intronic
1058175060 9:101725855-101725877 CATTCTCTGCTCAAATGCCATGG + Intronic
1059519429 9:114925964-114925986 TCTTATCTCCTCAAGAGACAGGG - Intronic
1061543842 9:131292329-131292351 CCTTCTTTCCCCATGTGACAAGG + Intronic
1185799980 X:3001657-3001679 CCTTCTCCCCTCAAGTGGCCTGG + Intergenic
1188930176 X:36099385-36099407 GGTTCTCTACTCATGTCACATGG - Intronic
1190003035 X:46707908-46707930 CCTTCTCTACTAAAAATACAAGG - Intronic
1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG + Exonic
1195615236 X:106906660-106906682 CCCTCTCTTCTCAGGGGACAAGG + Intronic
1196399586 X:115300091-115300113 CCCTCTCTTCTCAAGTGGAAGGG + Intronic