ID: 1130770273

View in Genome Browser
Species Human (GRCh38)
Location 15:86917110-86917132
Sequence GTGTTTAAAGTGCTGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130770269_1130770273 9 Left 1130770269 15:86917078-86917100 CCACATGGTTTGGCCTGCTAGGT 0: 1
1: 0
2: 1
3: 1
4: 82
Right 1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG 0: 1
1: 0
2: 4
3: 20
4: 174
1130770271_1130770273 -4 Left 1130770271 15:86917091-86917113 CCTGCTAGGTGCTGCACTGGTGT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG 0: 1
1: 0
2: 4
3: 20
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130770273 Original CRISPR GTGTTTAAAGTGCTGTTGGA AGG Intronic
900932382 1:5745561-5745583 ATGATCAAAGGGCTGTTGGAAGG - Intergenic
901162446 1:7189363-7189385 GTTTTTAATGTGCTCTTGTATGG - Intronic
907085499 1:51668895-51668917 CTGTGAAAAGTGCTCTTGGAGGG + Intronic
909262011 1:73502197-73502219 GTGTTTAAAAAGCAGCTGGATGG + Intergenic
910796010 1:91098637-91098659 GTGTGGGAAATGCTGTTGGAAGG + Intergenic
912937597 1:114017429-114017451 GTGTCTAAATTGCTGGAGGAAGG + Intergenic
913049656 1:115106143-115106165 GTGTTTAATGGGATGCTGGAAGG + Intergenic
913341927 1:117766765-117766787 GTGTTTATAGTATTCTTGGATGG + Intergenic
914447160 1:147759848-147759870 ATGTTTAAATGGCTGTTGGATGG + Intronic
915848972 1:159300452-159300474 GTTTTTAAGGTGCTGTCAGAGGG - Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
920412731 1:205774916-205774938 CTGTTCAAAGTGCTGGTGGTGGG - Exonic
921170681 1:212545711-212545733 GCCTTTAAAATGCTGATGGAAGG + Intergenic
1067958263 10:50817796-50817818 GAATTTAAAATGCTTTTGGATGG - Intronic
1068678275 10:59790649-59790671 GTGGAAAAAGTGCTGTTTGAAGG + Exonic
1071936538 10:90537925-90537947 GTGTTTACAAAGTTGTTGGAAGG + Intergenic
1072115535 10:92367046-92367068 ATGTTTCAAGTGCTGTAGTATGG - Intergenic
1072314074 10:94184628-94184650 GTGTATAAAGTTAGGTTGGAGGG - Intronic
1072880283 10:99220192-99220214 GTGTTTAAAGAGATGTTACAGGG + Intronic
1074437900 10:113450000-113450022 GTGTTTAAAGTTTGGGTGGACGG + Intergenic
1075021248 10:118954051-118954073 GTGTTTCAAGTGCAGCTGGTTGG - Intergenic
1078690290 11:13573112-13573134 GTGTTTATAGTACTGTCTGATGG - Intergenic
1078771361 11:14355394-14355416 ATGTGTAAAGTTCTGTTGGTAGG - Intronic
1079126533 11:17721589-17721611 GCTTTTAAAGCGCTGTTGGGAGG - Exonic
1081154402 11:39671357-39671379 GTGTTCAAAGTCCTATTGGAGGG - Intergenic
1085948620 11:81302787-81302809 GTGTTAAAGGTGCTGGTTGAGGG + Intergenic
1088223625 11:107594118-107594140 GTGTTTATGGTGGTGGTGGAGGG + Intronic
1088480237 11:110290180-110290202 GTGCTTAAAATGCTGCTGCAAGG + Intronic
1088877605 11:113948876-113948898 AAGTTTAAAGTGCTTTGGGAAGG + Intergenic
1090326776 11:125894328-125894350 GTTTTTAAAGAACTGTTAGATGG - Intronic
1092656380 12:10689202-10689224 TTGTTTATAGTGCTCTTAGAAGG - Intergenic
1093599633 12:21006029-21006051 GTGTTTATAGTGTTCTTTGATGG - Intergenic
1095905036 12:47368967-47368989 GTCTTTAAAGTGCTGTTTAGAGG - Intergenic
1096317663 12:50582660-50582682 GTGTTTTCACTGCTGTTGGTGGG - Intronic
1099012077 12:77303281-77303303 GTGTTCTAAATGCTGTAGGAAGG + Intergenic
1099749267 12:86750961-86750983 TTGTTTAAAGTGCTGTGAGAGGG + Intronic
1100907501 12:99318457-99318479 GTGTTTATAGTGTTCTTTGAGGG + Intronic
1101083033 12:101208543-101208565 TAGTTTAAAGAGCTGTTGAATGG - Intronic
1102300772 12:111769464-111769486 CTGTTCACAGTGCTCTTGGAGGG - Intronic
1104360803 12:128131280-128131302 GTGTTTGAAGTTGCGTTGGAAGG - Intergenic
1105294355 13:19075159-19075181 GTCTTTAAAGAGAGGTTGGAGGG + Intergenic
1105607558 13:21939279-21939301 GTATTTAAAGAGCTGTTTGAAGG - Intergenic
1107222844 13:38006049-38006071 GTGTTTATAGTACTCTCGGATGG + Intergenic
1111109951 13:83694040-83694062 GAGTTAAAATGGCTGTTGGATGG + Intergenic
1111476812 13:88760728-88760750 GTGTTCAATGTGCTGTTAAATGG - Intergenic
1112721086 13:102246457-102246479 CTGTTTTAAGTGCTTTTGCATGG - Intronic
1113228287 13:108182456-108182478 GTGTTTACATAGCTTTTGGAGGG + Intergenic
1113392681 13:109912636-109912658 AAGTTTAACTTGCTGTTGGAGGG + Intergenic
1114754447 14:25243983-25244005 CTGTTTACAAAGCTGTTGGAGGG - Intergenic
1115716389 14:36109591-36109613 GTTTTTAAAGTGTTCTTGGCTGG - Intergenic
1115980615 14:39047814-39047836 GTGTTTAGAGTGCTGTGTGCAGG - Intronic
1116194885 14:41712013-41712035 GTGTCTAATCTGCTGTTGGATGG - Intronic
1116236204 14:42282410-42282432 GTGTTTACAGTATTTTTGGATGG + Intergenic
1118970340 14:70631498-70631520 GTCTTTAAAGTTCTCCTGGAAGG + Intergenic
1120283429 14:82467192-82467214 GTGTTTACAGTATTCTTGGATGG - Intergenic
1121030470 14:90654441-90654463 GTGCTTAGAGTTCTGATGGATGG - Intronic
1121707092 14:96005288-96005310 GTGTTTATAGTATTCTTGGATGG - Intergenic
1121955620 14:98210163-98210185 GTGTTTAAACAGTTGCTGGAAGG + Intergenic
1122346328 14:101063116-101063138 GTGTTTACAGTGGAGTTGGTGGG + Intergenic
1123135017 14:106019866-106019888 GGGTATAAAGCGCTTTTGGACGG - Intergenic
1123585565 15:21757736-21757758 GGGTATAAAATGCTTTTGGACGG - Intergenic
1123622206 15:22200324-22200346 GGGTATAAAATGCTTTTGGACGG - Intergenic
1125410038 15:39396444-39396466 GAGCTTAAAGTGCAATTGGAAGG + Intergenic
1129291416 15:74570930-74570952 GTGCTGAAGGTGCTGTAGGAAGG + Intronic
1129958379 15:79660200-79660222 GTGATTAACGTGCTGCTGCATGG + Intergenic
1130770273 15:86917110-86917132 GTGTTTAAAGTGCTGTTGGAAGG + Intronic
1137440600 16:48495856-48495878 GTGTTTAAGCTGCTGTAGGCAGG + Intergenic
1139116061 16:63954569-63954591 GTTTCTAAAGTGGTGGTGGATGG - Intergenic
1139220881 16:65180359-65180381 TTGTTTAAAGGGAGGTTGGAAGG - Intergenic
1143601876 17:7952286-7952308 GCGTTTAAAGAGCTGTTTCAGGG - Intergenic
1143977082 17:10837835-10837857 GTCTTTAAACTGGGGTTGGAAGG - Intronic
1144449988 17:15368861-15368883 GTGTTTAAAGAGCACTTAGAGGG + Intergenic
1149820953 17:59776998-59777020 GTTTTTACAGGGCTGTTGGAGGG - Intronic
1153325899 18:3819870-3819892 GTGTTTTAAGGTCTGTTTGAAGG + Intronic
1155088842 18:22486159-22486181 GTGTATAAAGTGAATTTGGATGG - Intergenic
1155432800 18:25779040-25779062 CTTTTTAAATTCCTGTTGGACGG - Intergenic
1156827917 18:41455177-41455199 GTTTTTGAAGGGCTGTTTGAAGG - Intergenic
1164910525 19:32007618-32007640 AAGTGTAATGTGCTGTTGGATGG - Intergenic
1167763160 19:51462035-51462057 GTGTGGACAGTGCTGTGGGAGGG - Intergenic
1168043568 19:53778014-53778036 GCATATAAAGTTCTGTTGGATGG - Intergenic
1168178248 19:54641599-54641621 GTGTTGAATTTGCTGTTGGAAGG + Intronic
926156751 2:10459457-10459479 ATATTTAAAATGCTATTGGATGG + Intergenic
926524894 2:13967846-13967868 ATATTTAAAGTGCTGGGGGAAGG - Intergenic
928411178 2:31055352-31055374 GCGTTTAAAGTGCTATTCAAAGG - Intronic
928469480 2:31559623-31559645 ATGTATAAAGTGCTGTAAGATGG + Intronic
930359635 2:50361462-50361484 GTGTTTATAGTGTTCTTTGATGG - Intronic
932466585 2:71928044-71928066 GTGTTTGAGGTTCAGTTGGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934772395 2:96915412-96915434 GTTTTTAAAGTTTTGTTGGCTGG - Intronic
936639974 2:114301098-114301120 GTGTTTATAGTATTGTTTGATGG + Intergenic
937729362 2:125208948-125208970 TTGTTTAATGTGGTGTTAGAAGG + Intergenic
939951713 2:148483292-148483314 TTGTTTGAAGTGCTGTTGGATGG - Exonic
940030238 2:149254444-149254466 GTGTTTATAGTGTTCTTTGATGG + Intergenic
941285770 2:163610756-163610778 GTGTTTGAAATGCTGTTGTCGGG + Exonic
941658337 2:168168692-168168714 TTATTTAAAGTGCTTTTGGCTGG + Intronic
944341584 2:198606801-198606823 GTTTTTAAAATACTGTTGTAAGG - Intergenic
946066944 2:216996070-216996092 GTTTTTAAAGTGGTGGTGGGGGG + Intergenic
1171878944 20:30602589-30602611 GTCTTTAAAGAGAGGTTGGAGGG + Intergenic
1172046818 20:32086326-32086348 GCCTTTGAAGTGCTGTTGCAAGG - Intronic
1173223244 20:41146319-41146341 GTGCCTAAAGTGCTGTAGGCTGG + Intronic
1184954201 22:47872266-47872288 GTTTTTAAAATGCTGGTAGAGGG - Intergenic
952782555 3:37116435-37116457 GTTTTTAAAATGCTGGTTGAGGG - Intronic
954122383 3:48507007-48507029 CTGTTTACAGAGCTGTAGGAAGG - Intergenic
954828658 3:53399049-53399071 GTGATTAATGTGCTGTTGGAGGG + Intergenic
955000089 3:54919580-54919602 GTGTGTAGACTGCTGTTGGTCGG + Intronic
955437201 3:58914405-58914427 GTTTTTAAAGTACTCTTGCAGGG + Intronic
955517808 3:59745386-59745408 GTTTTTAAAGTGTTGTTGGATGG + Intergenic
955536349 3:59927901-59927923 GTGTTCAAAGAGATGGTGGAAGG - Intronic
960184853 3:114625749-114625771 GTGTTTGAAGTCCTGTTAGTGGG - Intronic
961779376 3:129312858-129312880 GCCTTTTAAGTGCTCTTGGAGGG + Intergenic
962421027 3:135229422-135229444 ATTTTTAAATAGCTGTTGGAGGG + Intronic
962623319 3:137200111-137200133 ATGTTAAAGGTGCTGCTGGAGGG - Intergenic
963314671 3:143746399-143746421 GTGTATTAAGTGCTGTGTGAGGG - Intronic
964007464 3:151849040-151849062 GTGTTTATAGTGTTCTTTGATGG + Intergenic
964366745 3:155958559-155958581 GCGTTTAAAGTGCTGTTAGTTGG - Intergenic
966856862 3:184200317-184200339 GTGTTAAAAATGCTGTAGTATGG - Intronic
967131798 3:186477313-186477335 TTTTTCAAAGTGCTGCTGGAGGG + Intergenic
967812415 3:193771956-193771978 AGGTTTACAGTGCTGTTGAAGGG + Intergenic
970041245 4:11799351-11799373 GCTTTTAAAATGCTGTTGGAGGG + Intergenic
971570816 4:28208518-28208540 CTGATTAAAGTGATGTTGAAAGG - Intergenic
972302103 4:37794118-37794140 GTTTTTAAAATGCAGTTTGATGG + Intergenic
973577367 4:52303600-52303622 GTCTTTAAAATGTTGTTGGCTGG + Intergenic
973894573 4:55398344-55398366 CTGTTTAACGTGCTGTTGTGAGG - Intronic
975453712 4:74564363-74564385 GTGTTTAAAGTATTCTTTGATGG - Intergenic
978443041 4:108754272-108754294 GTTTTTAAATTGCTCTTGGCCGG - Intronic
980102172 4:128552676-128552698 GTGTTTAAAGGGATATTGGTGGG + Intergenic
986615932 5:9617499-9617521 CTGTCTAAAGTACTGATGGATGG + Intergenic
987034817 5:14008736-14008758 ATGTTTAAAGTACTGTGGAAAGG - Intergenic
988059794 5:26151860-26151882 GTGTTTATAGTATTCTTGGATGG - Intergenic
989821218 5:45797344-45797366 GTATTAGAAGGGCTGTTGGAGGG - Intergenic
990216021 5:53532636-53532658 GTGTTTAAAGTGCAGACTGATGG - Intergenic
994790378 5:104218042-104218064 GTCTTTAAAATGCTGTGGGATGG - Intergenic
997409164 5:133677402-133677424 GTCCTTAATGTGCTGTTGCATGG - Intergenic
1000217384 5:159174197-159174219 GTGTTTAAAGTGTTTATTGATGG - Intronic
1000772545 5:165373901-165373923 GTGATTAAAATGCAGCTGGATGG + Intergenic
1000805923 5:165792216-165792238 ATGTTTGATGTGCTGTTGAAAGG + Intergenic
1000894694 5:166841677-166841699 ATGTCTTAAGTGTTGTTGGAAGG + Intergenic
1001672552 5:173486202-173486224 TTGATTGAAGTGTTGTTGGAAGG + Intergenic
1004809306 6:19242030-19242052 GTGTTTATAGTACTGTCTGATGG - Intergenic
1006948064 6:37798652-37798674 GGGTTTAAAGTGCAGTGGCAAGG - Intergenic
1007001401 6:38317292-38317314 ATGTTTAAACTGCTGAAGGAAGG - Intronic
1008473267 6:51908453-51908475 GTGTTGAAAGTGCTGATGAATGG + Intronic
1014144702 6:117984024-117984046 CTGTTTAAACTGTTGTTGGAGGG - Intronic
1017828739 6:158104611-158104633 ATGTTTAAAATGCTGCTGGTAGG + Intergenic
1018962259 6:168457347-168457369 GTGTTGAAGGTGGGGTTGGATGG - Intronic
1019149510 6:169994755-169994777 GTGCTTAAAGATGTGTTGGAGGG + Intergenic
1019192979 6:170264250-170264272 ATGTTTAATCTGCTGTTAGAAGG - Intergenic
1019375563 7:689990-690012 GTTTTTAAAGAGCTGAGGGAGGG + Intronic
1022376277 7:29814423-29814445 GTGTTTATAGTTTTGTTGCATGG + Intronic
1023309805 7:38873788-38873810 GTGTTTAGAATTCTGTAGGATGG - Intronic
1026476867 7:70743947-70743969 GTGGTTAAAGTGTGGATGGAGGG + Intronic
1028882919 7:95900148-95900170 GTGTTGAAAATGCAGTAGGATGG - Intronic
1030816557 7:114046868-114046890 GTGTTAAAAGATCTTTTGGACGG + Intronic
1031124245 7:117755837-117755859 GTGTCTTAAGTTCTGTTGAATGG + Intronic
1031126828 7:117783403-117783425 ATCTTTAAACTGCTTTTGGATGG + Intronic
1031464009 7:122085687-122085709 GAGTTTCAAGTGCTGTGCGATGG - Intronic
1033995110 7:147336382-147336404 GTGCTTAAACTCCTGTTGAAAGG - Intronic
1035053100 7:156015437-156015459 GTCTTTAAGGTCCTTTTGGATGG + Intergenic
1036367841 8:8136538-8136560 GTGTTAAAACTGCTGTTTGAAGG + Intergenic
1036883041 8:12529112-12529134 GTGTTAAAACTGCTGTTTGAAGG - Intergenic
1037085284 8:14841653-14841675 GTGTTATGAGTGCTATTGGAAGG + Intronic
1038151910 8:24949552-24949574 GAGATTCCAGTGCTGTTGGAGGG - Intergenic
1040883220 8:52231265-52231287 ATGCTTAAACTTCTGTTGGAAGG - Intronic
1051695511 9:19764104-19764126 GTGTTTATAGTATTCTTGGATGG + Intronic
1051914188 9:22188280-22188302 GTGTTTACAGTGTTCTTTGATGG - Intergenic
1053567343 9:39267349-39267371 GAGTTTAAAGTAGTGTTGGATGG - Intronic
1053833068 9:42105082-42105104 GAGTTTAAAGTAGTGTTGGATGG - Intronic
1054129800 9:61351649-61351671 GAGTTTAAAGTAGTGTTGGATGG + Intergenic
1054597484 9:67082327-67082349 GAGTTTAAAGTAGTGTTGGATGG + Intergenic
1055629052 9:78204276-78204298 GTGTTTAAAGTGTTCTTGGATGG - Intergenic
1057051361 9:91926580-91926602 GTGTTTCAAATCCTGTTGCAAGG - Intronic
1057377254 9:94536267-94536289 GTGTTTAAATTCCTGTAGGGTGG + Intergenic
1060215816 9:121737718-121737740 CTGTTTGAAGTCCTGTGGGAGGG + Intronic
1060308657 9:122439289-122439311 GTTTTTACAGTTCTGTGGGAAGG + Intergenic
1060354429 9:122891567-122891589 GTGTGTTGAATGCTGTTGGAAGG - Intronic
1061188186 9:129067308-129067330 GCGTTTAAAGTGCCGCTGCACGG - Intronic
1062613068 9:137383607-137383629 GTGGTTGAAGTGCTGCTGGGCGG - Intronic
1186312552 X:8336333-8336355 GTGTTTAAAGTGGGGGTGGAGGG + Intergenic
1186649870 X:11547738-11547760 ATCTTTAAAGTGCAGTTGCAGGG - Intronic
1186900555 X:14050913-14050935 GTGTTAAAAATGCTGTTGCCTGG + Intergenic
1188483372 X:30656606-30656628 TTTTTAAAAGTGCTGTAGGAAGG - Intronic
1189509223 X:41645164-41645186 GTTTTTAAAGTGCGATTGTAAGG - Intronic
1191135090 X:57055537-57055559 GTGTTTAAAGTATTTTTTGATGG + Intergenic
1191601552 X:63014610-63014632 GTGTTTAAAGTATTCTTTGATGG + Intergenic
1192994278 X:76495974-76495996 GTGTTTATAGTATTGTTTGAGGG - Intergenic
1193464313 X:81828820-81828842 GTGTTGAAAGTGCTTCTGGCAGG + Intergenic
1194052190 X:89083128-89083150 GTGTTCAAACTGATATTGGAAGG + Intergenic
1196587520 X:117446774-117446796 GTGTTTATAGTGTTCTTAGATGG - Intergenic
1196637314 X:118017659-118017681 GTTTCTTAAGTGCTGTTGAAAGG - Intronic
1197564223 X:128061747-128061769 GTGTTTATAGTGTTATTTGATGG - Intergenic
1197842970 X:130769699-130769721 GTGTGTCAGGTGATGTTGGATGG - Intronic
1197875575 X:131101164-131101186 ATGTTTAAAGTACTGTAAGAAGG - Intergenic
1198276642 X:135100297-135100319 GTTTTTAAAATGATGTTTGATGG + Intergenic
1198276808 X:135102342-135102364 GTTTTTAAAATGGTGTTTGATGG - Intergenic
1198342362 X:135727286-135727308 GTGTTTATAGTACTCTTTGATGG + Intergenic
1198345628 X:135756009-135756031 GTGTTTATAGTACTCTTTGATGG - Intergenic
1201933750 Y:19383588-19383610 GTGTTTATAGTGCTGTCTGATGG + Intergenic
1202346965 Y:23941237-23941259 GTGTATAATGTCCTGTTGCAAGG + Intergenic
1202523806 Y:25728853-25728875 GTGTATAATGTCCTGTTGCAAGG - Intergenic