ID: 1130774471

View in Genome Browser
Species Human (GRCh38)
Location 15:86964420-86964442
Sequence ACAAAAAATGTGTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1421
Summary {0: 1, 1: 1, 2: 37, 3: 147, 4: 1235}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130774465_1130774471 0 Left 1130774465 15:86964397-86964419 CCACCACTACCCCCACTGTGATA 0: 1
1: 0
2: 1
3: 19
4: 235
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774467_1130774471 -9 Left 1130774467 15:86964406-86964428 CCCCCACTGTGATAACAAAAAAT 0: 1
1: 0
2: 10
3: 60
4: 468
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774463_1130774471 25 Left 1130774463 15:86964372-86964394 CCACTAGATGTCAGAAGCACATT 0: 1
1: 2
2: 4
3: 89
4: 432
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774466_1130774471 -3 Left 1130774466 15:86964400-86964422 CCACTACCCCCACTGTGATAACA 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774468_1130774471 -10 Left 1130774468 15:86964407-86964429 CCCCACTGTGATAACAAAAAATG 0: 1
1: 1
2: 7
3: 83
4: 495
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774462_1130774471 26 Left 1130774462 15:86964371-86964393 CCCACTAGATGTCAGAAGCACAT 0: 1
1: 2
2: 34
3: 180
4: 745
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235
1130774464_1130774471 1 Left 1130774464 15:86964396-86964418 CCCACCACTACCCCCACTGTGAT 0: 1
1: 0
2: 1
3: 24
4: 261
Right 1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG 0: 1
1: 1
2: 37
3: 147
4: 1235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130774471 Original CRISPR ACAAAAAATGTGTCCAGACA TGG Intronic
900724764 1:4208688-4208710 ACAAAAAATGTCTCCAGGAGAGG + Intergenic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
901015542 1:6227698-6227720 ACAAAAAATTTAGCCAGGCATGG + Intronic
901047948 1:6409991-6410013 AAAAAAAATTTGTGGAGACAGGG - Intergenic
901106204 1:6758518-6758540 ACAAAAAAATTGGCCAGACGGGG - Intergenic
901510277 1:9715019-9715041 ACAAAAAATTTAGCCAGGCATGG + Intronic
901538210 1:9897162-9897184 ACAAAAAACGTGGCCAGGCACGG + Intronic
901543002 1:9933097-9933119 ACAAAAAAAGTAGCCAGGCATGG + Intronic
901576746 1:10207429-10207451 AAAAAAAAAGTAGCCAGACATGG - Intergenic
901782827 1:11605349-11605371 TCCAAAAATGTCTCCAGTCATGG + Intergenic
901851058 1:12015912-12015934 AGAATATTTGTGTCCAGACATGG - Intergenic
901874512 1:12159536-12159558 AAAAAAAAATTGTCCAGGCATGG + Intergenic
901902067 1:12373409-12373431 GCAAAAAATTTGGCCAGGCACGG - Intronic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902284797 1:15400547-15400569 ACTAAAATTATGTCCAGACATGG - Intergenic
902338382 1:15767043-15767065 AAAAAAAATGTAGCCAGGCATGG - Intronic
902406366 1:16185851-16185873 ACAAAAAAATTGGCCAGGCACGG - Intergenic
902549197 1:17209255-17209277 GCAGAGAATGTGTCCAGCCAGGG - Intronic
902619353 1:17641823-17641845 ACAAAAAAATTAGCCAGACATGG + Intronic
902728908 1:18355816-18355838 AAAAAAAAAGAGTCTAGACATGG - Intronic
902864968 1:19271925-19271947 ACACAAAATTTGGCCAGGCATGG + Intergenic
902981984 1:20130634-20130656 ACAAAAAATTTAGCCAGGCATGG - Intergenic
903223743 1:21883471-21883493 ACAAAAAATCTAGCCAGGCATGG - Intronic
903238400 1:21965893-21965915 AAAAAAAATTTGTACATACAGGG - Intergenic
903247835 1:22029184-22029206 ACAAAAATTATGGCCAGGCATGG - Intergenic
903771047 1:25764566-25764588 ACAAAAAAAGTAGCCAGACATGG - Intronic
904141469 1:28357030-28357052 ACAAAAATTGTTTCCAGGCTGGG + Intergenic
904155942 1:28483237-28483259 ACAAAAAACTTAGCCAGACATGG + Intronic
904522337 1:31105346-31105368 ACAAAAAAAGTGTCCGGGCATGG - Intergenic
904535579 1:31197399-31197421 ACAAAAAATTAGGCCAGACGTGG - Intronic
904770728 1:32879816-32879838 ACAAAAAATTAGGCCAGGCATGG + Intergenic
904993448 1:34612694-34612716 ACAAAGAATGTGGCCAGCCCAGG + Intergenic
905046464 1:35007291-35007313 ATAAAAACTGTGGCCAGGCACGG + Intronic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905754939 1:40501192-40501214 ACAAAAAAATTAGCCAGACATGG - Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
906423488 1:45689550-45689572 ACAAAAATTGGGGCCAGGCACGG + Intronic
907214999 1:52855341-52855363 ACAAAAATTATGACCGGACATGG - Intronic
907254781 1:53170704-53170726 AAAAAAAAAGAGTCCAGGCATGG + Intergenic
907402893 1:54235921-54235943 TCAAAAAATGTCACCAGAAAAGG - Intronic
907448186 1:54523252-54523274 AAAAAAAATGTAGCCAGACGTGG + Intergenic
907851402 1:58258508-58258530 ATGAAAAATGAGTCCAGACAGGG - Intronic
907855152 1:58295935-58295957 ACAAAAAAATTATCCAGGCATGG + Intronic
907869640 1:58431765-58431787 TCAACAAATGTGTCCAAAGAAGG - Intronic
908231140 1:62106313-62106335 AAAAAAAAATTGTCCAGCCATGG + Intronic
908280163 1:62525159-62525181 ACAAAAAAATTAGCCAGACATGG - Intronic
908282734 1:62559195-62559217 GCAAAAAATTTGTCAAGATAAGG + Exonic
908628224 1:66071716-66071738 ACAAAAAATCTGTCATAACAGGG - Intronic
908738426 1:67301874-67301896 AAAAAAAATGAGGCCAGGCACGG + Intergenic
909490788 1:76224207-76224229 AAATAAAATCTCTCCAGACAAGG - Intronic
909772591 1:79442263-79442285 TATAAAAATGTGTCCAGCCAGGG - Intergenic
909779303 1:79522501-79522523 ACAAAAAATGTGTCCAGGCTGGG + Intergenic
909895211 1:81060643-81060665 ACAAAATATGTTTCCGGGCATGG - Intergenic
910293736 1:85623742-85623764 ACCAAGAATGTGGCCAGGCATGG + Intergenic
910846989 1:91613311-91613333 ACAAAAAAAGAGGCCAGACATGG + Intergenic
910883704 1:91944751-91944773 AAAAAAAAGGTGTAGAGACAGGG - Intergenic
910938525 1:92507370-92507392 ACCCAAAATGTCTCCAAACATGG - Intergenic
910953052 1:92671975-92671997 AAAAAAAATTTGTGGAGACAGGG + Intronic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911580293 1:99626083-99626105 ACAAAAAAATTATCCAGGCATGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
911852251 1:102834717-102834739 ACAAGAAATGTGTGCAGACCAGG + Intergenic
912120932 1:106472003-106472025 AAAGAAAATGTGGCCAGGCACGG + Intergenic
912205103 1:107500204-107500226 ACAAAAAAATTGGCCAGGCATGG + Intergenic
912427436 1:109607159-109607181 AAAAAAAAGGTGGCCAGGCACGG + Exonic
912628566 1:111227147-111227169 AAAAAAAATTTGTAGAGACAGGG - Intronic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
912767481 1:112427738-112427760 ACAAAAAAATTAGCCAGACATGG + Intronic
912783959 1:112580770-112580792 ACAAAAAAATTAGCCAGACATGG + Intronic
913353742 1:117894281-117894303 AGAAAAAAATTGGCCAGACATGG - Intronic
914444434 1:147738011-147738033 ACAAAAATTGTGGCAAGACCAGG - Intergenic
914461365 1:147888792-147888814 AAAAAAAATCTGTAGAGACAAGG - Intergenic
914822241 1:151113514-151113536 ACAGAAGATTTGGCCAGACACGG - Intronic
915329599 1:155102145-155102167 ACAAAAAAGTTCTCCAGGCATGG + Intergenic
915385434 1:155487519-155487541 ACAAAAAAATTAGCCAGACATGG - Intronic
915435828 1:155905351-155905373 ACAAAAAAATTAGCCAGACATGG - Intronic
915504399 1:156344295-156344317 ACATAAGATGTGTTAAGACATGG - Intronic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916224009 1:162472081-162472103 ACAAGAAATGTGGACAGCCATGG - Intergenic
916754547 1:167756415-167756437 AAAAAAAATCTGGCCAGACAAGG - Intronic
916911946 1:169360211-169360233 ACAAAAAATAAGTCCAGAAATGG + Intronic
917286717 1:173428849-173428871 ACAAAACTTGTGGCCAGGCATGG + Intergenic
917542065 1:175923790-175923812 ACAAAAAGTGTGTGCTGGCAGGG - Intergenic
917808494 1:178635516-178635538 AAAAAAAATTTATCCAGGCATGG + Intergenic
917865778 1:179193694-179193716 ACAAAAAATTAGGCCAGGCACGG - Intronic
917908921 1:179619791-179619813 AAAAAAAATTTGTAGAGACAGGG + Intronic
917939805 1:179907271-179907293 ACAAAAAATTTGGTCAGGCATGG + Intronic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918594331 1:186275500-186275522 AAAAAAAATTTGGCCAGGCATGG + Intergenic
918875487 1:190036516-190036538 ACAAAAAAATTATCCAGGCATGG + Intergenic
918900386 1:190408939-190408961 ACAAAAAATTTCTTTAGACAAGG - Intronic
918943411 1:191029381-191029403 ACAAAAAATGTAGCCAGGTATGG + Intergenic
918994444 1:191738859-191738881 ACATAAACTTTGTCCAGAGAGGG - Intergenic
919201034 1:194355967-194355989 ACAAACAAACTGTCCAGGCATGG - Intergenic
919447875 1:197732145-197732167 ACAAAACAAGTGACCAGACTTGG - Intronic
919657467 1:200211984-200212006 ACAAAAAATTTGGCCAGGCATGG - Intergenic
920217690 1:204373061-204373083 AGAAAAAATATAGCCAGACATGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921057920 1:211558150-211558172 ACAAAAAAATTATCCAGTCATGG + Intergenic
921278271 1:213540639-213540661 TTAAAAACTGTGACCAGACATGG - Intergenic
921494357 1:215820231-215820253 GAAAAAAATGTGTGTAGACATGG - Intronic
922022357 1:221717547-221717569 ACAAAAAATGCATTCAGAAAAGG - Intronic
922288654 1:224191748-224191770 ACAAAAAAATTAGCCAGACATGG - Intronic
922576598 1:226665042-226665064 AAAAAAAATGTAGCCAAACAAGG - Intronic
922890730 1:229059916-229059938 ACAACAAACGTGTCCTGACTGGG + Intergenic
923140521 1:231158591-231158613 ACACAAAAATTATCCAGACATGG - Intergenic
923601050 1:235403360-235403382 ACAAAAAAATTGGCCAGACGTGG - Intronic
924721102 1:246623905-246623927 AAAAAAAATGTAGCCAGGCACGG + Intronic
924902411 1:248415408-248415430 ACAAAAAAAGTGACAAGAAAGGG + Intergenic
1063102050 10:2958858-2958880 CCAAAAAATGTGCCCACACAGGG + Intergenic
1063673662 10:8120381-8120403 ACAAAAAATGTAGCCAGGCGTGG - Intergenic
1063881114 10:10533702-10533724 ACAAAGGCTTTGTCCAGACAAGG + Intergenic
1063900551 10:10728147-10728169 AAAAAAAATGTGACCAGTCGCGG + Intergenic
1063975978 10:11415889-11415911 ACACAAAAAGTATCCAGGCATGG - Intergenic
1064051120 10:12060373-12060395 ACAAAAATTAAGTCCAGGCACGG - Intergenic
1064444719 10:15383197-15383219 ACAAAAAATTTATCCAGATGTGG + Intergenic
1064525848 10:16255917-16255939 ACTTAAAATGTGGCCAGGCACGG + Intergenic
1064554142 10:16531837-16531859 ATAAACTATGTGTCCAAACAGGG + Intergenic
1064567146 10:16652834-16652856 AAAAAAAATGTAGCCAGGCATGG - Intronic
1064851012 10:19708634-19708656 AAAATAAATGTGGCCAGGCACGG - Intronic
1065446136 10:25802952-25802974 AAAAAAAATGTCTCTAGACATGG + Intergenic
1065485270 10:26230932-26230954 ACAAAAAAATTAGCCAGACAAGG + Intronic
1065662409 10:28019648-28019670 AAAAAAAATCTGTAGAGACAGGG + Intergenic
1065753172 10:28907105-28907127 ACAAGAAGTGTGGCCGGACATGG - Intergenic
1065775988 10:29120778-29120800 AAAAATAATGTATCCAGGCACGG - Intergenic
1066056958 10:31690988-31691010 AAAAAAAATCTGGCCAGGCACGG + Intergenic
1066095768 10:32070330-32070352 ATAAAAAATCTGGCCAGGCACGG - Intergenic
1066208063 10:33209195-33209217 AAAAAATATGTGGCCAGGCATGG - Intronic
1066384122 10:34927689-34927711 TCAAAAAATCTGGCCAGGCACGG - Intergenic
1066465776 10:35648802-35648824 TCAAAAAATTGGTCCAGGCAAGG + Intergenic
1067047457 10:42992536-42992558 CCAAGAAATGTGGCCAGTCAGGG + Intergenic
1067345645 10:45436937-45436959 CCAAAGAATGTATCCAGCCAAGG - Intronic
1067732839 10:48824792-48824814 AAAAAAAATTTATCCAGGCAAGG - Intronic
1068754217 10:60632574-60632596 AAAAAAAATTTGTAAAGACAGGG - Intronic
1068782773 10:60939532-60939554 CCAAAAAGTGTGTGTAGACAAGG - Intronic
1068822112 10:61389267-61389289 ACAAAAAAATTGGCCAGGCATGG - Intergenic
1069541107 10:69294564-69294586 CTAAAAAATGTGGCCAGGCACGG + Intronic
1069543084 10:69310128-69310150 AAAAAAAATCTGGCCAGGCATGG + Intronic
1070487796 10:76947179-76947201 ACAAAAAAAGTAGCCAGGCATGG + Intronic
1070950243 10:80425439-80425461 ACAGAAAATGTCACCAAACAGGG + Intronic
1071545501 10:86525927-86525949 AAAAAAAATGTGGCCAGGCATGG - Intergenic
1072069609 10:91903734-91903756 ACAAAAAAAGTGGCCGGGCACGG - Intergenic
1072249359 10:93569368-93569390 ACTAAAATTGTGTGCTGACAGGG + Intronic
1072471252 10:95716035-95716057 AAAAAAAATTTGTGCAGTCAGGG + Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1073169915 10:101497548-101497570 AAAAAAAATTTATCCAGGCATGG + Intronic
1073633778 10:105176563-105176585 ACAAAAAACATGGCCAGGCACGG + Intronic
1073741145 10:106408563-106408585 ACAAAAAATTTTTTCAGAGATGG + Intergenic
1074097899 10:110330142-110330164 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1074119325 10:110481742-110481764 ACCCAAAATGTTTCCAGACATGG + Intergenic
1074172114 10:110951809-110951831 ACAGAAAAATTGGCCAGACATGG - Intronic
1074185312 10:111096077-111096099 TCAAATAATGTGGCAAGACAAGG - Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1074501203 10:114026436-114026458 CCTAAAAATGTCCCCAGACATGG + Intergenic
1074665626 10:115720013-115720035 ACAAAAAATATATCCAGGCCTGG - Intronic
1075338230 10:121624256-121624278 AAAAAAAAGTTGTCCAGGCACGG + Intergenic
1075379393 10:122006291-122006313 ACAAAAAAATTGGCCAGGCATGG + Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075646729 10:124101690-124101712 TCAAAAAATGAGACCAGCCAAGG + Intergenic
1075688920 10:124382524-124382546 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1075698578 10:124453440-124453462 ACAAAAAATTAGGCCAGGCACGG - Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078044904 11:7904739-7904761 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1078182764 11:9026618-9026640 AAAAAAAATGTATAGAGACAGGG + Intronic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078843652 11:15102255-15102277 ACAAACACTGTGTCCTCACATGG + Intergenic
1078974967 11:16463234-16463256 ACAAAAAATATATAAAGACAAGG - Intronic
1079228352 11:18627721-18627743 ACAAAAAAAGTAGCCAGGCATGG + Intronic
1079302923 11:19295283-19295305 AAAAAAAATCTGGCCAGGCACGG - Intergenic
1079636317 11:22746024-22746046 ACAAAAAATTTAGCCAGGCATGG + Intronic
1079646305 11:22867252-22867274 ACAAAAATTGTGTGGAGACTCGG - Intergenic
1079649245 11:22906246-22906268 ACACAAAATCTGTACAAACATGG - Intergenic
1080071473 11:28093643-28093665 ACAAAAAATGATTACAGAAAGGG + Intronic
1080104477 11:28497700-28497722 ACAGACAATGTGTCCTCACATGG + Intergenic
1080471216 11:32547329-32547351 ACAAAAAAATTAGCCAGACATGG - Intergenic
1080494185 11:32799380-32799402 ACAAAAAATGGGGCCAGGCATGG - Intergenic
1080505543 11:32909593-32909615 ACAAAAAAACTGGCCAGGCATGG - Intronic
1080679132 11:34457494-34457516 ACAGAAAATGAGGCCAGCCACGG - Intronic
1080830117 11:35885222-35885244 ACAAAAAAATTATCCAGGCATGG + Intergenic
1080831309 11:35895735-35895757 ACAAAAAAATTAGCCAGACATGG + Intergenic
1081379755 11:42400027-42400049 ACAAAAAAATTAGCCAGACATGG - Intergenic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1081707282 11:45190300-45190322 ACAAAAAAATTAACCAGACATGG - Intronic
1081868110 11:46370786-46370808 TTAAAAAATGTGTTCAGACTGGG + Intronic
1081868157 11:46371095-46371117 ACAAAAAATGTGTTCAAAGCTGG + Intronic
1081939777 11:46930929-46930951 AAAAAAAAAGTGCCCAGACTAGG - Intergenic
1082694244 11:56340486-56340508 ACTAAAAATTTGTCTAGTCAGGG - Intergenic
1082877231 11:58000686-58000708 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1082909754 11:58357503-58357525 ACAAAAAAATTAGCCAGACATGG - Intergenic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1083189396 11:61038714-61038736 ACAAAAAAAGTAGCCAGACGTGG - Intergenic
1083284480 11:61649443-61649465 AAAAAAAATTTTTCGAGACAGGG + Intergenic
1083376310 11:62225195-62225217 ATACAAAATGTGCCCAGAAAGGG + Intergenic
1083469486 11:62873497-62873519 AAAAAAATTTTGTACAGACAAGG + Intronic
1083693788 11:64429006-64429028 ACCAAAGATGTCTCCAAACATGG - Intergenic
1083766173 11:64842640-64842662 ACAAAAGCTTCGTCCAGACAGGG - Intronic
1083772160 11:64873965-64873987 AAAAAAAATGTGGCCGGGCACGG - Intronic
1084039751 11:66535186-66535208 ACAAAAGTTGTGTCCAGGCCAGG - Intronic
1084141315 11:67231902-67231924 ACAAGAAATGTGTCCCCACAGGG + Exonic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084747446 11:71182149-71182171 AAAAAAAATCTCTCCAAACATGG + Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1085004268 11:73070577-73070599 ACAAAAAAATTAGCCAGACATGG - Intronic
1085089197 11:73695533-73695555 ACAAAAAAATTAGCCAGACATGG - Intronic
1085353966 11:75818986-75819008 ATCAAAAATGAGTTCAGACATGG + Intronic
1086425769 11:86680998-86681020 ACAAAAAATGTTTGCAGAATAGG - Intergenic
1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG + Intergenic
1087960687 11:104345070-104345092 ACAAAAAAATTATCCAGGCATGG - Intergenic
1088255744 11:107902015-107902037 ATAAGAAATGGGTCCAGTCACGG + Intronic
1088260285 11:107937310-107937332 AAAAAAAATTTGTAGAGACAGGG + Intronic
1088353826 11:108920867-108920889 ACTAAAAATGTCTTCAGACATGG + Intronic
1088476502 11:110245240-110245262 ACAAAAAATTTGGCCAGGCGTGG - Intronic
1088636717 11:111828032-111828054 ACAAAAAAATTGGCCAGGCATGG + Intronic
1088639003 11:111852780-111852802 ACAAAAAAATTAGCCAGACATGG + Intronic
1088760986 11:112928640-112928662 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1088868750 11:113874154-113874176 AAAAAAAGTGCGTCCAGACTGGG + Intronic
1089109421 11:116043429-116043451 ACAAAAAAATTACCCAGACATGG + Intergenic
1089245937 11:117120051-117120073 ACAAAAAATTAGGCCAGGCACGG + Intergenic
1089497483 11:118914978-118915000 ACACAAAAATTATCCAGACATGG + Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089873289 11:121695806-121695828 ACAAAAAAATTATCCAGGCATGG - Intergenic
1089877380 11:121738079-121738101 ACAAAAAAATTGGCCAGGCATGG - Intergenic
1090004616 11:122990523-122990545 ACAAAAAAATTATCCAGGCAGGG + Intergenic
1090011690 11:123050921-123050943 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1091291908 11:134445250-134445272 ACAAAAAAAATTTCCAGGCATGG - Intergenic
1091478560 12:801927-801949 ACAAACAATGGGGACAGACAAGG - Intronic
1091492467 12:945058-945080 AGAAAAAAAGTGGCCAGGCACGG + Intronic
1091585607 12:1814591-1814613 ATAGAAAATGTGTCCTGAAATGG - Intronic
1091739901 12:2953620-2953642 AAAAAAAATGTGGCCAGGCACGG - Intergenic
1092264717 12:6971754-6971776 ACAAAAAGTGTGGGCAGACTAGG - Intronic
1092271496 12:7027436-7027458 AGAAAAAAAGCGGCCAGACATGG - Intronic
1092356191 12:7797344-7797366 AAAAAAAAATTGCCCAGACACGG - Exonic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1092761656 12:11816398-11816420 ACAAAAAATTTAGCCAGGCATGG - Intronic
1092893826 12:12994267-12994289 ACAAAAAAGGTGTTCTGGCAGGG + Intronic
1093009727 12:14093835-14093857 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1093455107 12:19357398-19357420 ACAAAAAATTTAGCCAGGCATGG - Intronic
1093710827 12:22328015-22328037 ACCAAATATGTCTCCAGACTTGG - Intronic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1094660869 12:32469432-32469454 ACAAAAAAATTATCCAGGCATGG - Intronic
1095166560 12:38980288-38980310 ACAAAAAAATTATCCAGGCATGG + Intergenic
1095173503 12:39062384-39062406 TAAAAAAATGTGTAGAGACAGGG + Intergenic
1095430493 12:42128845-42128867 AAAAAAAATTTGTAGAGACAGGG + Intronic
1095556102 12:43506766-43506788 AAAAAAAAGGTGGCCAGGCACGG - Intronic
1095964887 12:47860117-47860139 ACAAAAAAATTGGCCAGGCATGG - Intronic
1095996509 12:48091152-48091174 AAAAAGAATGTGTCAAGACTGGG + Intronic
1096046219 12:48564573-48564595 AAAAAAAAAGAGGCCAGACACGG + Intergenic
1096662348 12:53133966-53133988 ACAAAAAAGTTAGCCAGACATGG - Intergenic
1096731311 12:53615226-53615248 ACAAAAAAATTGGCCAGGCATGG + Intronic
1097594808 12:61616042-61616064 AGAAAAAATGTGGCCAGTCGTGG + Intergenic
1097841297 12:64324078-64324100 ACATAAACTCTGTCCAAACATGG + Intronic
1098016141 12:66106972-66106994 ACAAAAAAATTAGCCAGACATGG - Intergenic
1098080806 12:66783322-66783344 AGAAACAATGTGGCCAGGCATGG - Intronic
1098293989 12:68985523-68985545 ACAAAAAAATTATCCAGGCATGG + Intergenic
1098379742 12:69854537-69854559 ACAAAAAAATTAGCCAGACATGG - Intronic
1098454356 12:70655522-70655544 ACAAAATATGTGTCCTAAAATGG + Intronic
1098561624 12:71879286-71879308 ACAAAAAAGTTAGCCAGACATGG - Intronic
1099331606 12:81296013-81296035 ACAAAAAATGAGGCCAGGCGCGG + Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100465127 12:94837576-94837598 ACAAAAAAATTAGCCAGACATGG - Intergenic
1100493554 12:95103688-95103710 ACAAAAAAATTAGCCAGACATGG - Intronic
1100835527 12:98563485-98563507 TCAGAAAGTGTGTCCAGGCATGG - Intergenic
1100899436 12:99221182-99221204 ACAAAAAAATTGGCCAGGCATGG + Intronic
1101004040 12:100384445-100384467 ACAAAAAATTTGGCCAGACATGG + Intronic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1101333800 12:103778648-103778670 GCAAAAAATTTGACCAGGCATGG + Intronic
1101370836 12:104128819-104128841 ACAAAAAAATTGGCCAGGCATGG - Intronic
1101463338 12:104920603-104920625 AAAAAAATTTTGTCGAGACAGGG - Intronic
1101704356 12:107207562-107207584 ACAAAAAAATTGGCCAGGCATGG - Intergenic
1101799176 12:108005776-108005798 AAAAAAAATGAGCCCAGAGAAGG - Intergenic
1101878631 12:108611452-108611474 ACCAAACACGTCTCCAGACATGG + Intergenic
1101947311 12:109147378-109147400 AAAAAAAAAGTAGCCAGACATGG - Intronic
1102276470 12:111586050-111586072 ACAAAAAATTTAGCCAGTCATGG - Intronic
1102308367 12:111824152-111824174 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1102596502 12:113996821-113996843 ATAAAAAATGTCTCCAGGCCAGG + Intergenic
1102700250 12:114832863-114832885 ACAAAAAACGTGGCAGGACATGG - Intergenic
1102765497 12:115429402-115429424 ACAAATAATGTTTACTGACATGG + Intergenic
1103046406 12:117738582-117738604 ACAAAAAATGTGGCTGGGCATGG + Intronic
1103047575 12:117750092-117750114 ACAAAAAAATTAGCCAGACATGG + Intronic
1103076610 12:117988206-117988228 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1103189733 12:118991093-118991115 AAAAAACATGGGTCCAGGCATGG - Intronic
1103287146 12:119812099-119812121 ACAAAAAAAGTATCCAGGCATGG - Intronic
1103618573 12:122171500-122171522 ACAAAAAAATTAGCCAGACATGG - Intronic
1103655142 12:122464790-122464812 ACAAAAAAATTATCCAGGCATGG + Intergenic
1104249516 12:127078503-127078525 ACATTAAATGAGTCCATACATGG - Intergenic
1104325098 12:127788308-127788330 AAAAAAAATTTAGCCAGACATGG - Intergenic
1104595249 12:130116078-130116100 ACAAAATATGGGGCCAGGCACGG + Intergenic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1104700240 12:130897469-130897491 AAAAAGAAAGTGGCCAGACATGG - Intergenic
1105312492 13:19225202-19225224 ACAAAAAAACTGGCCAGGCACGG + Intergenic
1105981101 13:25517069-25517091 AAAAAAAATGTGACCAGGCACGG - Intronic
1106037394 13:26056497-26056519 AGAAAAAATTTGTAGAGACAGGG - Intergenic
1106056023 13:26238074-26238096 AAAAAAAAATTATCCAGACATGG - Intergenic
1106838402 13:33660737-33660759 ATAAAGAATGTAGCCAGACATGG - Intergenic
1107150924 13:37110327-37110349 ATAAAAACAGTGTCTAGACAAGG + Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107494608 13:40913668-40913690 AAAAAGAATGTGGCCAGGCATGG - Intergenic
1107832754 13:44389006-44389028 ACAAAACTTGTGGCCACACAGGG - Intronic
1107937300 13:45355987-45356009 ACAAAAAAAGTAGCCAGCCATGG - Intergenic
1107948823 13:45443942-45443964 ACAAACACTGTGTCCTCACATGG - Intergenic
1108032235 13:46244595-46244617 ACAGAAAATTTGTAGAGACAGGG - Intronic
1108333548 13:49415224-49415246 ATAAAAAATGTGGCCAGGCGCGG + Intronic
1108668635 13:52657929-52657951 AAAAAGAATGTGGCCAGGCATGG + Intronic
1108669953 13:52675896-52675918 ACCCACAATGTCTCCAGACATGG + Intronic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1108977634 13:56468562-56468584 AATAAAAATGTCTCCACACAAGG + Intergenic
1109009735 13:56925318-56925340 ACAAAAAATGCACCAAGACAGGG + Intergenic
1109370463 13:61414797-61414819 GCAAGAAATGTATCCAGATAAGG - Intronic
1109416659 13:62049707-62049729 ACAAAAAATGTAGCCAGGCATGG + Intergenic
1109827683 13:67743931-67743953 AAAAAAAAAGTGGCCAGGCATGG - Intergenic
1109847079 13:68007735-68007757 ACAAAAAATGTTTTCAGCCATGG + Intergenic
1110388014 13:74937232-74937254 ACAAAAAATTTAGCCAGGCAAGG + Intergenic
1110433318 13:75451522-75451544 ATAAAAAATGTAGCCAGGCATGG + Intronic
1110434185 13:75460765-75460787 AAAAAAAAAATGGCCAGACATGG + Intronic
1110676446 13:78252018-78252040 ACAAAATATGTATACATACATGG - Intergenic
1110755225 13:79165434-79165456 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1110995420 13:82101839-82101861 ACAAAAAAATTAGCCAGACATGG - Intergenic
1111291588 13:86178206-86178228 CCAAAATATGTTTCCAGACATGG - Intergenic
1112018834 13:95353993-95354015 ACCAAAAATGTGTCCAGGCTGGG + Intergenic
1112359590 13:98705451-98705473 ACAAAAAATGTCTCCAGAGATGG + Intronic
1112960836 13:105124131-105124153 ACAAACAATTTGGCCAGGCACGG + Intergenic
1112999724 13:105620099-105620121 ACAAAAAATGTATCCTAATATGG + Intergenic
1113058176 13:106291510-106291532 AGAAAAAGAGTGTCCAGAGAGGG + Intergenic
1113627071 13:111855251-111855273 ACAAAAAAATTATCCAGACATGG - Intergenic
1114300331 14:21370767-21370789 AAAAAAAATTTATCCAGGCATGG - Intronic
1114501536 14:23172687-23172709 ACCAAAAGTGTCTCCAGATACGG - Intronic
1115045594 14:28989314-28989336 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1115123481 14:29965610-29965632 AAATAAAATGTGGCCAGGCATGG - Intronic
1115201298 14:30856871-30856893 ACAAAAAAATTAGCCAGACATGG - Intergenic
1115520003 14:34223934-34223956 AGAAAGAATGTGTCCACAGAAGG + Intronic
1115554597 14:34534826-34534848 AAAAAAAATTTGTGGAGACAGGG - Intronic
1115637618 14:35305803-35305825 ACAAAATATGTGCCCAGGCCAGG + Intronic
1115692597 14:35860283-35860305 ACAAAAAAATTATCCAGACATGG - Intronic
1116052279 14:39819672-39819694 ACAAAAAAATTAGCCAGACATGG - Intergenic
1116119228 14:40700536-40700558 ATAAGAATTGTGTCCACACAGGG + Intergenic
1116140939 14:40993729-40993751 ACAAAAAATTTAGCCAGACATGG + Intergenic
1116250851 14:42481565-42481587 AGTAAAAATGTGTCCAGAATTGG + Intergenic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1116990650 14:51272586-51272608 ACAAAACAGGTGGCTAGACATGG + Intergenic
1117447032 14:55813917-55813939 ACAAACACTGTGTCCTCACATGG - Intergenic
1117516188 14:56504115-56504137 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1117590525 14:57263475-57263497 ACAAAAAAACTGGCCAGGCACGG + Intronic
1117924895 14:60768052-60768074 ACAAAAAATAAGGCCAGTCATGG - Intronic
1117975170 14:61290001-61290023 AGGAAAAATGTGTCCAGGCACGG + Intronic
1118007485 14:61576712-61576734 ACAGAAAATCTTTCCAGACTGGG - Intronic
1118190748 14:63577914-63577936 ACAAAAAATTTGGCCGGCCATGG - Intergenic
1118196405 14:63630648-63630670 AAAAAAAAAAAGTCCAGACAAGG + Intronic
1118200502 14:63667432-63667454 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1118208390 14:63744516-63744538 ACAAAAAAATTAGCCAGACATGG + Intergenic
1118267864 14:64312751-64312773 ACAAAAAAATTATCCAGGCATGG + Intronic
1118279552 14:64416087-64416109 ACAAAAAAATTATCCAGGCAGGG + Intronic
1118391504 14:65299577-65299599 ACAAAAAAAGGCTCCTGACAGGG + Intergenic
1118584489 14:67339944-67339966 ACAAAAAAATTATCCAGGCATGG + Intronic
1118709156 14:68505704-68505726 ACAAAAAAGTTGGCCAGGCATGG - Intronic
1118967914 14:70605450-70605472 ACAAAAAAAATGGCCAGGCACGG - Intergenic
1119047184 14:71329445-71329467 ATAAAAAATTTTTCGAGACAGGG + Intronic
1119937223 14:78603031-78603053 ACAAAAAAAGTGCCAAGAAATGG - Intronic
1120210211 14:81626803-81626825 ACCAAAAATGTCTTCAGTCATGG + Intergenic
1120287585 14:82523818-82523840 ACAAAAGATGTTTCCAGAAATGG - Intergenic
1120377303 14:83726443-83726465 ACAAAAGCTGTGTCCTCACATGG - Intergenic
1121146062 14:91583261-91583283 ACAAAAAATTTAGCCAGGCATGG + Intronic
1121206776 14:92175911-92175933 ACAAAAAATGTTTATAAACATGG - Intergenic
1121546295 14:94766052-94766074 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1121959004 14:98241160-98241182 AAAAAAAATGTGTTTAGACTTGG + Intergenic
1122144389 14:99680796-99680818 ACAAAAAAACTGGCCAGGCATGG - Intergenic
1122734378 14:103828211-103828233 ACAAAAAAATTAGCCAGACATGG + Intronic
1122757428 14:103993123-103993145 AAAAAAAATTTGGCCAGGCATGG - Intronic
1123073099 14:105651750-105651772 GCAAAGACTGTTTCCAGACAAGG + Intergenic
1123107446 14:105849239-105849261 GCAAAGACTGTTTCCAGACAAGG - Intergenic
1123478634 15:20611459-20611481 ATAAAAAATTTATCCAGGCAAGG - Intergenic
1123639379 15:22388926-22388948 ATAAAAAATTTATCCAGGCAAGG + Intergenic
1123712554 15:22999554-22999576 ATACAAAATGTATCCAGACATGG - Exonic
1123892538 15:24795659-24795681 AGAAGAAATCTGTCCAGGCACGG - Intergenic
1123931183 15:25172414-25172436 AGAAGACATGTGTCCAAACATGG - Intergenic
1124655830 15:31506026-31506048 AAAAAAATTGTGGCCAGGCATGG - Intronic
1124783927 15:32661322-32661344 ACAGAAAATGTCTCCAGGCCAGG + Intronic
1124921470 15:34030770-34030792 ACAAAAAATTTAGCCAGGCACGG - Intronic
1124946069 15:34267674-34267696 ACAAAAATTTTGTAGAGACAAGG - Intronic
1125250876 15:37701757-37701779 ACATAAAATGTGTACATACAGGG + Intergenic
1125302123 15:38266484-38266506 ACAAAAAAATTATCCAGGCATGG + Intronic
1125650788 15:41315970-41315992 ACAAAAAAATTAGCCAGACATGG + Intronic
1125659986 15:41386253-41386275 ACAAAAAAAGTAGCCAGACATGG + Intergenic
1125660354 15:41389615-41389637 ACAAAAAACTTATCCAGCCATGG + Intronic
1125821278 15:42633942-42633964 ACATGAAATGAGGCCAGACAGGG - Intronic
1125836597 15:42757281-42757303 AAAAAAAATTTGCACAGACAGGG + Intronic
1125887034 15:43236811-43236833 ACAAAAAATTTAGCCAGGCATGG + Intronic
1126013920 15:44331168-44331190 ACAAAAAATATAGCCAGGCATGG - Intronic
1126422682 15:48491504-48491526 ACAAAAAAAGTAGCCAGGCACGG - Intronic
1126650752 15:50919240-50919262 ATAAATAATGTGGCCAGGCACGG + Intronic
1126676731 15:51165395-51165417 AAAAAAAAAATGTCCAGAAATGG + Intergenic
1126760109 15:51962006-51962028 ACAAAAAATTTAGCCAGGCATGG + Intronic
1127334636 15:57971595-57971617 AAAAAAAATTGGTACAGACAGGG + Intronic
1127669657 15:61183243-61183265 TTAAAAAATGTGGCCAGGCATGG + Intronic
1127684872 15:61333549-61333571 ACAAATATTGTATCTAGACATGG - Intergenic
1128006627 15:64248692-64248714 ATAAAAAATATGGCCAGGCACGG + Intronic
1128010329 15:64288882-64288904 TCAAAAATTGTGGCCAGACATGG + Intronic
1128068723 15:64780234-64780256 ACAAAAAGTATGGCCAGGCACGG - Intergenic
1128190268 15:65686873-65686895 AAAAAAAAATTGTACAGACAGGG + Intronic
1128448778 15:67788684-67788706 ATTAAAAATTTGGCCAGACATGG + Intronic
1128457771 15:67842191-67842213 AAAAAAAAAGAGTCCAGACATGG - Intergenic
1128467592 15:67925906-67925928 AAAAAAAATTTAGCCAGACATGG - Intergenic
1128657993 15:69476542-69476564 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1128954345 15:71924395-71924417 ACAAAAAATTTAGCCAGGCATGG - Intronic
1129158926 15:73736262-73736284 ACACAAAATGTGGCCAGCTAGGG - Exonic
1129272400 15:74426117-74426139 ACAAAAAAATTAGCCAGACATGG + Intronic
1129422992 15:75444571-75444593 ACTAAAATTGAGTCCAGACCAGG + Intronic
1129497691 15:76001285-76001307 ACAAAAATTGGGGCCAGGCATGG - Intronic
1129565015 15:76612390-76612412 ACAAAAAAATTAGCCAGACATGG - Intronic
1129565763 15:76621570-76621592 ACAAGAACTGTGCCCAGACATGG + Intronic
1129602097 15:77005228-77005250 ACAAAAAATGTAGCCAGGTATGG + Intronic
1129813464 15:78530354-78530376 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1129860094 15:78854045-78854067 AAAAAAAATTTGGCCAGGCACGG - Intronic
1129918522 15:79296782-79296804 ACCAAAAATGTCTCTAGACGTGG + Exonic
1130092678 15:80834105-80834127 TCCCAAAATGTCTCCAGACATGG + Intronic
1130315581 15:82792786-82792808 ACAAAAACTTAGGCCAGACACGG - Intronic
1130774471 15:86964420-86964442 ACAAAAAATGTGTCCAGACATGG + Intronic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131040893 15:89265810-89265832 ACAAAAAATCCGGCCAGGCACGG - Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131251353 15:90832469-90832491 AAAAAAAAGGCGGCCAGACATGG + Intergenic
1131253292 15:90845021-90845043 AAAAAAAATTTGGCCAGGCATGG - Intergenic
1131277736 15:90995967-90995989 AAAAAAAAAGTATCCAGGCATGG - Intergenic
1131486743 15:92827224-92827246 ACAAAAAATTAGGCCAGGCACGG - Intergenic
1131493047 15:92879601-92879623 ACAAAAAAATTAGCCAGACATGG + Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1132472115 16:110701-110723 ACAAAAAAATTAGCCAGACATGG - Intronic
1132946417 16:2533856-2533878 ACAAAAACTGGGCGCAGACAAGG - Intergenic
1133066479 16:3211136-3211158 ACAAAAAAATTATCCAGGCATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133190830 16:4132534-4132556 AAAAAAAAAGAGCCCAGACACGG + Intergenic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133319858 16:4906378-4906400 ACAAAAAAATTATCCAGGCATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133607873 16:7405908-7405930 ACTAAAAATGTCTCTGGACATGG - Intronic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1133800559 16:9081742-9081764 AAAAAAAATGTAGCCAGGCATGG + Intergenic
1133826244 16:9280707-9280729 ACCAAAAATGTCTCTAGATATGG - Intergenic
1133949783 16:10381329-10381351 ACAAAAAAACTGTAGAGACAGGG + Intronic
1134034899 16:11022323-11022345 AAAAAAAAGGTAGCCAGACATGG - Intronic
1134125204 16:11611816-11611838 ACAAAAAAACTATCCAGGCATGG - Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134263560 16:12673693-12673715 ACAGAAAATGTGACCAAACGAGG + Intronic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134748178 16:16603952-16603974 ACAAAAAATTTAGCCAGTCATGG - Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134859204 16:17545958-17545980 ACAAAAAAATTAACCAGACATGG - Intergenic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1134906678 16:17985851-17985873 AAAAAAAAAGTGGTCAGACAAGG + Intergenic
1134997286 16:18749670-18749692 ACAAAAAATTTAGCCAGTCATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135258175 16:20958362-20958384 AAAAAAATTCTGTCCAGGCATGG - Intronic
1135273758 16:21092423-21092445 ACAAAAAAAGAATCTAGACACGG + Intronic
1135350064 16:21721375-21721397 ACCAAAAATGTTTGCAGACATGG - Intronic
1135615969 16:23911416-23911438 ACAAAAAATTGGACCAGGCATGG - Intronic
1135638727 16:24101381-24101403 ACAAAAAATTTAGCCAGGCATGG + Intronic
1135690434 16:24533031-24533053 AAAAAAAATGGGGCCAGGCACGG + Intergenic
1136049902 16:27642733-27642755 AAAAACAATGTGTCCAGCCTGGG - Intronic
1136386364 16:29928782-29928804 ATAAAAAATATGGCCAGGCATGG - Intergenic
1136492589 16:30619207-30619229 ACAAACAATGTCGTCAGACACGG + Intronic
1136542196 16:30934206-30934228 ACAAAAAATTTAGCCAGGCATGG + Intronic
1136627407 16:31470535-31470557 ACAAAAAAATTAGCCAGACATGG - Intergenic
1137262909 16:46845489-46845511 AACAAAAATGTGGCCAGGCACGG + Intergenic
1137518065 16:49167355-49167377 ACACAAAAGGTGTTAAGACAAGG + Intergenic
1137640423 16:50024265-50024287 ACAAAAAAATTATCCAGACGTGG - Intergenic
1137783538 16:51117932-51117954 ACAAAAAAGGTAGCCAGGCATGG - Intergenic
1137893180 16:52183605-52183627 AACATAAATGTGTACAGACATGG - Intergenic
1137928103 16:52561030-52561052 ACAAAAATTTTGTAAAGACAGGG + Intergenic
1138359744 16:56418007-56418029 ACAACAAATGTAGCCAGGCATGG + Intronic
1138606298 16:58091655-58091677 AGAAAAAATATGGCCAGGCACGG + Intergenic
1138710712 16:58967394-58967416 AAAAAAAATTTGTAGAGACAGGG - Intergenic
1138823297 16:60287447-60287469 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1138855291 16:60683781-60683803 ACAAGAAATAAGTCCAGAGATGG + Intergenic
1139476509 16:67205311-67205333 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1139513396 16:67439861-67439883 ACAAAAAATTTAGCCAGGCATGG + Intronic
1139567668 16:67789317-67789339 AAAAAAAATGTACCCAGGCATGG + Intronic
1139627095 16:68198890-68198912 ACAAAAAAACTAGCCAGACATGG + Intronic
1139905523 16:70363022-70363044 AAAAAAAATTTGTAGAGACAGGG + Intronic
1140061882 16:71577627-71577649 AAAAAAAATGTTGCCAAACAAGG - Intergenic
1140498407 16:75410616-75410638 ACAAAAAAAAAGTCCAGGCACGG + Intronic
1140520319 16:75575449-75575471 TCAAAAAAAGTATCCAGGCATGG - Intronic
1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG + Intergenic
1140700189 16:77574536-77574558 ACCAAAAATGAATCCAGACATGG + Intergenic
1140711034 16:77677815-77677837 ACAAAAAACGTAGCCAGGCATGG + Intergenic
1141178823 16:81738677-81738699 TCAAAAACTGTCTCCAGATAGGG + Intergenic
1141440007 16:84024124-84024146 ACCCAAAATGTCTGCAGACATGG + Intronic
1141743017 16:85906777-85906799 CCAAAAAAGGTCTCCAAACATGG - Intronic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1141756132 16:85992200-85992222 ACAAAAAATGTCCCCAGACATGG + Intergenic
1141758310 16:86009874-86009896 ACAAATAAGGTGTCCAGACAGGG - Intergenic
1142220002 16:88849574-88849596 ACAAAAAAGTTGGCCTGACACGG - Intronic
1142482761 17:228833-228855 ACAGAAAAAGGGTCCAGAGAGGG - Intronic
1142633384 17:1240861-1240883 ACAAAAAAATTAGCCAGACATGG + Intergenic
1142830425 17:2545104-2545126 ACAAAAAAATTAGCCAGACACGG - Intergenic
1143070084 17:4284443-4284465 ACAAAAAATTTAGCCAGGCATGG + Intronic
1143087944 17:4430680-4430702 ACAAAAAAATTATCCAGGCACGG - Intergenic
1143187908 17:5021634-5021656 ATAAAAAATGTAGCCAGGCATGG - Intronic
1143764483 17:9128577-9128599 AGAAAAAATGAGTCCAAAAATGG - Intronic
1143968220 17:10772471-10772493 CCAAAAAATGGGGCCAGAGATGG + Intergenic
1144043533 17:11434032-11434054 AGAAAAAATGTTTCCAAACAAGG - Intronic
1144143806 17:12377361-12377383 ACAAAGAATCAGTCCAGAAAGGG + Intergenic
1144309392 17:13998446-13998468 ACAAAAAAATTATCCAGGCATGG + Intergenic
1144407231 17:14963942-14963964 AAAAAAAATGTTTTCAGATAAGG + Intergenic
1144481554 17:15634037-15634059 AAAAAAAATTTGGCCAGGCACGG + Intronic
1144602334 17:16628105-16628127 ACAAAAAAATTGGCCAGGCATGG + Intronic
1144640839 17:16935696-16935718 ACAAAAAATATGATCAGAAAGGG - Intronic
1144747030 17:17622728-17622750 AAAAAAAAAGTGGCCAGGCATGG - Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1144886945 17:18469635-18469657 AAAAAAAATGTGGCCAGACATGG - Intergenic
1145145270 17:20474659-20474681 AAAAAAAATGTGGCCAGACATGG + Intergenic
1145183374 17:20772700-20772722 AAAACAAATGTGGCCAGGCATGG - Intergenic
1145193961 17:20870199-20870221 ACAAAAAAAGTGTCCTGGCGTGG - Intronic
1145298079 17:21610973-21610995 ACAAAAAAAGTGTCCTGGCGTGG + Intergenic
1145352182 17:22092426-22092448 ACAAAAAAAGTGTCCTGGCGTGG - Intergenic
1145353550 17:22113347-22113369 ACAAAAAAATTAGCCAGACATGG + Intergenic
1145404376 17:22572200-22572222 ACAAAAAAAGTGTCCTGGCGTGG - Intergenic
1145848196 17:28063085-28063107 ACAAAAAAATTAGCCAGACATGG - Intronic
1146047369 17:29520415-29520437 AAAAAAAATTTGTAGAGACAGGG - Intronic
1146078629 17:29756808-29756830 ACAAAAAAAGTAGCCAGCCATGG - Intronic
1146217805 17:30992356-30992378 AAAAAAATTGAGGCCAGACATGG - Intronic
1146315471 17:31803358-31803380 AAAAAAAAAGTATCCAGGCATGG + Intergenic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1146741736 17:35290817-35290839 ACAAAAAAATTAGCCAGACATGG + Intergenic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147507212 17:41030513-41030535 ATAAACAATTTGTCCAGACTTGG + Intergenic
1147749954 17:42724876-42724898 ATAAAAAATTTGACCAGGCATGG + Intronic
1147753274 17:42750585-42750607 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148026147 17:44589080-44589102 AAAAAAAAAGTGTAGAGACAGGG + Intergenic
1148099004 17:45075777-45075799 ACAAAAAAAGAGGCCAGGCACGG + Intronic
1148099085 17:45076457-45076479 AAAAAAAAAGTGGCCAGGCACGG + Intronic
1148204684 17:45772658-45772680 AAAAAAAAAGTATCCAGTCATGG - Intergenic
1148580733 17:48741844-48741866 AAAAAAAATGTACCCAGGCATGG - Intergenic
1148705271 17:49624762-49624784 AAAAAAATTGTGGCCAGGCATGG - Intronic
1149756180 17:59187873-59187895 AAAAAAAGTGTGTCAAGACTAGG + Intronic
1150063131 17:62085918-62085940 TCAAAAGAAGTTTCCAGACAAGG + Intergenic
1150383625 17:64740278-64740300 ACCAAAAATGTCTCCAGGCCAGG + Intergenic
1150903529 17:69311643-69311665 ACAAAAAAATTATCCAGCCATGG - Intronic
1150928745 17:69561852-69561874 ACAAAAAAATTGACCAGGCATGG + Intergenic
1150956103 17:69862324-69862346 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1150990242 17:70249458-70249480 ATAAAAAATTTATCCAGGCATGG - Intergenic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151331574 17:73412760-73412782 ACAAAAAAATTAGCCAGACATGG + Intronic
1151438080 17:74110688-74110710 AAAAAAAATGTGTATACACAGGG + Intergenic
1151595655 17:75076805-75076827 ACAAAAAAATTGGCAAGACATGG - Intergenic
1151613753 17:75194405-75194427 AAAAAAAATTTAGCCAGACATGG - Intergenic
1151731008 17:75911062-75911084 ACAAGGAATGTTTACAGACAAGG - Intronic
1152075457 17:78156903-78156925 AAACAAAATGTGTCCAGGCACGG - Intronic
1152097899 17:78282691-78282713 ACAAAAAAAGTGTTCACAGATGG + Intergenic
1152154876 17:78626440-78626462 ACAAAAAAATTAGCCAGACATGG - Intergenic
1152217011 17:79039209-79039231 ACAAAAAATGTCTCCAAACATGG - Intronic
1152653581 17:81508756-81508778 AAAAAAAATTTGTAGAGACAAGG + Intergenic
1152764761 17:82130188-82130210 AAAAAAAATGTTTTGAGACAGGG - Intronic
1153055917 18:946126-946148 ATTAAAAATGTGGCCAGGCATGG - Intergenic
1153187116 18:2498309-2498331 ACAAAAAAATTAGCCAGACACGG - Intergenic
1153212771 18:2786278-2786300 GCAAACAAAGTGGCCAGACACGG - Intronic
1153239882 18:3021377-3021399 AAAAAAAATCTGTGGAGACAAGG + Intergenic
1153885934 18:9466119-9466141 ACAAAATATGCTTCAAGACAAGG - Intergenic
1153937277 18:9939721-9939743 ACCAAAAATGTTTCCAAGCACGG - Intronic
1154000780 18:10480710-10480732 AAAAAAAATTTATCCAGTCATGG + Intronic
1154154528 18:11933605-11933627 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1154227910 18:12524984-12525006 AAAAAAAAAGTGGCCAGGCACGG + Intronic
1154301283 18:13194843-13194865 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1155013358 18:21806191-21806213 AAAAAAAATCTGGCCAGGCATGG - Intronic
1155513735 18:26603274-26603296 ACAAAAAAACTAGCCAGACATGG + Intronic
1155832673 18:30537690-30537712 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1156111264 18:33730127-33730149 ACAAAAAACATCTCCAAACATGG - Intronic
1156548156 18:37986556-37986578 AAAAATAATGTGTCAAGACAGGG + Intergenic
1156870400 18:41938939-41938961 AAAAAAAATCTGTAGAGACAGGG - Intergenic
1157381654 18:47224059-47224081 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1157767314 18:50309638-50309660 AAAAAAAATATAGCCAGACATGG - Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1158162306 18:54499113-54499135 ACAAATGATGTGTCCTTACATGG + Intergenic
1158165334 18:54533531-54533553 AGAACAAATTTGTCAAGACAGGG + Intergenic
1158363946 18:56708779-56708801 ACAAAAAAATTATCCAGGCATGG + Intronic
1158445295 18:57515256-57515278 ACAAAAAATTTTTTGAGACAAGG + Intergenic
1158504175 18:58031510-58031532 ACAAAAAAATTAGCCAGACATGG + Intergenic
1158583210 18:58704152-58704174 ATAAAACATATGTCCAGAAAAGG - Intronic
1158596633 18:58822229-58822251 ACAAAAAATTTGGCCGGGCATGG + Intergenic
1159398161 18:67891860-67891882 ACAGAAAATGTGTGCAGGCTTGG - Intergenic
1159437382 18:68436549-68436571 ACAGAGAATTTGTCCTGACAGGG + Intergenic
1159565416 18:70042529-70042551 ACAAAAAAATTAGCCAGACATGG - Intronic
1159869941 18:73749871-73749893 AAAAAAAATGTGTAAATACATGG + Intergenic
1161261716 19:3341473-3341495 ACAAGTAATGTGTCCAGTGAGGG + Intergenic
1161263598 19:3352039-3352061 ACAAAAATTCTTGCCAGACATGG + Intergenic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161340077 19:3736557-3736579 ACAAAAAATGAACCCAGATAAGG - Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161685311 19:5699711-5699733 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1161945547 19:7434163-7434185 ACAAAAAATTTATAGAGACAGGG + Intronic
1162006182 19:7781159-7781181 GCAAGAAATGTGTACAGACCAGG + Intergenic
1162102852 19:8350766-8350788 ACAAAAAATTTAGCCAGGCATGG + Intronic
1162115654 19:8427823-8427845 AAAAAAAAAAAGTCCAGACACGG + Intronic
1162136265 19:8557301-8557323 ACAAAAAAAGTTTTGAGACAGGG + Intronic
1162154892 19:8671004-8671026 AAAAAAAAGATTTCCAGACATGG + Intergenic
1162158106 19:8693706-8693728 ACAAGAAATGGGGCCAGGCATGG - Intergenic
1162258587 19:9513669-9513691 ACAAGAAATGTGCACAGACCAGG - Intergenic
1162517623 19:11158704-11158726 AAAAAAATTGTGTCCGGGCATGG - Intergenic
1162570295 19:11467772-11467794 ACTAAAAATGGGGCCAGACGCGG - Intronic
1162684692 19:12372301-12372323 ACAAAAAAATTATCCAGACATGG + Intergenic
1162699031 19:12499913-12499935 ACAAAAAATTTAGCCAGGCATGG - Intronic
1162772799 19:12959890-12959912 AAAAAAAACGTGGCCAGTCATGG - Intergenic
1162774084 19:12968507-12968529 ACAAAAATTATGGCCAGGCACGG - Intronic
1162977980 19:14219593-14219615 ACAAAAAAATTAGCCAGACATGG + Intergenic
1163022435 19:14490208-14490230 ACAAAAAATTAGGCCAGGCACGG + Intronic
1163030447 19:14540680-14540702 ACAAAAATTATGGCCAGGCACGG - Intronic
1163118919 19:15204179-15204201 AAAAAAACTGTGGCCAGGCATGG - Intergenic
1163214836 19:15868836-15868858 ACAAAATATGTAGCCAGGCATGG - Intergenic
1163283103 19:16329217-16329239 ACCAAAAATGTTCCCAGACTGGG - Intergenic
1163346074 19:16743199-16743221 ACAAATAATGGGGCCAGGCAAGG - Intronic
1163386502 19:17003191-17003213 AAAAAAAAGGTGGCCAGGCATGG - Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1163467568 19:17477395-17477417 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1163540205 19:17904336-17904358 ATCAAAATTGTTTCCAGACATGG + Intergenic
1163601306 19:18250760-18250782 AAAAAAAAATTGTCCAGGCATGG - Intronic
1163855686 19:19700330-19700352 ACAAAAAAATTAGCCAGACATGG - Intergenic
1163997130 19:21061796-21061818 AAAAAAAATGTGGCCTGGCACGG + Intergenic
1164065973 19:21717268-21717290 AAAAAAAAACTGACCAGACACGG - Intergenic
1164154911 19:22587578-22587600 ACCCAAAATGTGTACACACAAGG + Intergenic
1164280556 19:23764738-23764760 ACATAAAATGTTTACAGACTTGG - Intronic
1164290643 19:23866000-23866022 GCAAGAAATGTGTGCAGACCAGG + Intergenic
1164825667 19:31283176-31283198 ACAAAAAAATTAGCCAGACATGG + Intronic
1164886491 19:31782945-31782967 AAAAAAAATTTGTGGAGACAGGG - Intergenic
1165140485 19:33696996-33697018 ACAAAAAATTTAGCCAGGCATGG - Intronic
1165235791 19:34420613-34420635 AAAAAAAATTTGTAGAGACAGGG - Intronic
1165376391 19:35445694-35445716 AAATCAAATGTGTCCAGACCTGG - Intronic
1165526868 19:36363550-36363572 ACCAAAATTGTCTCCAGATATGG - Intronic
1165646807 19:37446392-37446414 ACAAAAAAATTATCCAGGCATGG + Intronic
1165807371 19:38588761-38588783 AAAAAAAATTTATCCAGGCATGG + Intronic
1166154839 19:40903195-40903217 ACAATAAATGCGGCCAGGCATGG + Intergenic
1166168049 19:41006311-41006333 AAAAAAAATGTAGCTAGACATGG - Intronic
1166173237 19:41047126-41047148 ACAATAAATGCGGCCAGACATGG - Intergenic
1166292986 19:41875155-41875177 AAAAAAAAAGTGGCCAGCCACGG + Intergenic
1166534817 19:43566240-43566262 AAAAAAAAAGTGGCCAGGCACGG + Intronic
1166602032 19:44104815-44104837 ACAAAAAAATTAGCCAGACATGG - Intronic
1166646370 19:44534746-44534768 ACAATAAATGCCTCCAGACTTGG + Intergenic
1166676395 19:44743782-44743804 AAAAAAAATCTGTAGAGACAGGG + Intergenic
1166791494 19:45401367-45401389 AAAAAAAATTTGTAGAGACAGGG + Intronic
1167024596 19:46905972-46905994 AAAAAAAATGTGGCCAGGCACGG - Intergenic
1167065095 19:47179349-47179371 ACAAAAAAATTAGCCAGACATGG + Intronic
1167111096 19:47461864-47461886 ACTAAGAATGTGTCCAGCCTGGG + Intronic
1167271113 19:48506952-48506974 ACAAAAAAATTGGCCAGGCACGG - Intronic
1167312101 19:48742880-48742902 ACAAAAAAATTAGCCAGACATGG - Intronic
1167451675 19:49574013-49574035 ACAAAAAAAGTATCTAGGCATGG - Intronic
1167782686 19:51610056-51610078 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1167808831 19:51810618-51810640 GCAAGAAATGTGTGCAGACCAGG - Intronic
1167826382 19:51977412-51977434 GCAAGAAATGTGTGCAGACCAGG + Intronic
1167886364 19:52503178-52503200 ATAAAAAATAAGGCCAGACATGG - Intronic
1167941836 19:52953747-52953769 ATATAAAATAAGTCCAGACATGG + Intronic
1168062940 19:53904103-53904125 AAAAAAAATTTGGCCGGACATGG + Intronic
1168244833 19:55107121-55107143 AAAAAAAATGTGACCAGGCACGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168499164 19:56878886-56878908 AAAAAAAATGTAGCCAGGCATGG - Intergenic
1168679876 19:58307005-58307027 GCAAGAAATGTGTGCAGACCAGG + Intronic
925541150 2:4969287-4969309 ACAAAAAATTTAGCCAGGCATGG + Intergenic
926177892 2:10612833-10612855 ATAAAAAATGTGTAGAGACAAGG - Intronic
926246984 2:11129162-11129184 AAAAAAAATTTGGCCAGGCATGG + Intergenic
926948634 2:18216807-18216829 ACAAAAAATCTGGCCGGACGCGG + Intronic
927008249 2:18874336-18874358 AAAAAAAATGCGTCCAGATCAGG + Intergenic
927117489 2:19919223-19919245 ACAAAAAATTTAGCCAGGCATGG + Intronic
927145308 2:20161485-20161507 ATTAAAAATGTGGCCAGGCATGG - Intergenic
927250377 2:20990954-20990976 ACAAAGAATCTGTCCAGACCAGG - Intergenic
927558582 2:24052792-24052814 AAAAAAAATTTGTAGAGACAGGG - Intronic
927664597 2:25021798-25021820 ACTAAAAATATGTACAAACATGG - Intergenic
927668732 2:25051265-25051287 ACAAAAAAATTAGCCAGACATGG - Intronic
927957717 2:27219496-27219518 ACAAAAAAAGTAGCCAGGCATGG - Intronic
928206942 2:29291188-29291210 AAAAAAAAATTGTACAGACAGGG - Intronic
928218047 2:29378864-29378886 ACAAAAAAAGTAGCCAGGCATGG - Intronic
928492937 2:31803127-31803149 AAAAAAAAAGTATCCAGGCATGG + Intergenic
928575944 2:32655142-32655164 AAAAAAAAATTGGCCAGACATGG - Intronic
928809930 2:35211341-35211363 ACAAAAAATGTAGCCAGGCGTGG - Intergenic
929180762 2:39036504-39036526 ACAAAAAATGTAACCAGGCGCGG - Intronic
929250434 2:39748695-39748717 ACAAAAAAAGTGGCCAGGTATGG + Intronic
929314960 2:40465942-40465964 ACAAATACTGTGTCCTCACATGG - Intronic
929342718 2:40842614-40842636 ACAAACAATGAGGCCAGACGCGG + Intergenic
929362776 2:41114182-41114204 ACAAAAAATGTGTGCACTTAAGG + Intergenic
929494359 2:42427306-42427328 AATAAAAATGTTTCCTGACAGGG + Intergenic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
929727717 2:44447883-44447905 AAAAACAAAGTGGCCAGACAGGG - Intronic
930074084 2:47392334-47392356 ACAAAAAAAATGGCCAGACTTGG - Intergenic
930145393 2:47997139-47997161 ACAAAAATTGTGTAGAGACAAGG + Intergenic
930207868 2:48606580-48606602 ACAAAAAAATTGGCCAGGCACGG + Intronic
930255935 2:49091457-49091479 ACAAAAAATATAGCCAGGCATGG - Intronic
930305627 2:49671048-49671070 ACAAACATTGTGTCCTTACATGG - Intergenic
930345859 2:50180195-50180217 AAAAAAAATTTGTAGAGACACGG + Intronic
930377004 2:50580599-50580621 ACAAGAAATGTGTCAAGTGAAGG + Intronic
930423795 2:51187688-51187710 AAAAATAATGTGAACAGACAAGG + Intergenic
930527479 2:52548016-52548038 AAAAAAAAGGTATCCAGGCATGG - Intergenic
930651369 2:53968117-53968139 ACAAAAAAAGTAGCCAGGCATGG + Intronic
931072488 2:58668643-58668665 ACAAAAAATTTAGCCAGGCATGG - Intergenic
931111436 2:59115497-59115519 AAAAAAAAATTATCCAGACATGG - Intergenic
931112867 2:59131943-59131965 AGAGAAAATGTATCCACACAAGG + Intergenic
931371832 2:61670329-61670351 ACAAAAAAATTATCCAGGCATGG - Intergenic
931378200 2:61727156-61727178 TCAAAAAGTGTGTCCATAAAGGG + Intergenic
931384309 2:61783699-61783721 ATAAAAAAATTATCCAGACATGG - Intergenic
931488047 2:62713395-62713417 ACAAAAAAACTAGCCAGACATGG - Intronic
931513006 2:63020966-63020988 AAAAAAAATGAGGCCAGGCACGG - Intronic
931513861 2:63029882-63029904 ACAAAAAAATTGGCCAGGCATGG - Intronic
932797585 2:74710697-74710719 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
932815794 2:74860712-74860734 ACTAAAAACGTGTCCACAAAAGG - Intronic
933063246 2:77765090-77765112 ACAAAAAAATTAACCAGACATGG - Intergenic
933227958 2:79772735-79772757 AAAAAAAATGTGTAGAGACAGGG + Intronic
933621047 2:84541764-84541786 ACAAAAAAAATGTGAAGACAAGG - Intronic
933680102 2:85092155-85092177 ACAAAAAAGGGTTTCAGACATGG + Intergenic
934084853 2:88501642-88501664 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
934089019 2:88534730-88534752 ACAAAAAAATTGGCCAGGCATGG + Intergenic
934570597 2:95369784-95369806 ACAAAAAAATTGCCCAGGCATGG - Intronic
935544483 2:104386462-104386484 ACAAAAAAGTTATCCAGGCATGG - Intergenic
936297604 2:111278852-111278874 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
936597224 2:113859888-113859910 AAAAAAAATGTGGCCAGGGACGG + Intergenic
936669023 2:114633766-114633788 ACAAAAAAATTAGCCAGACATGG - Intronic
936684425 2:114811369-114811391 GCAAAAACTGTGTGCAGAGATGG - Intronic
936864938 2:117066636-117066658 ACCAAATATGTCTCCAGACCTGG - Intergenic
937020415 2:118645924-118645946 AAAACAACTGTGTGCAGACAAGG + Intergenic
937115677 2:119403483-119403505 ACCAAAAATGTAAGCAGACAGGG - Intergenic
937524780 2:122754955-122754977 ACCAAAAATGTCCCTAGACATGG + Intergenic
937819967 2:126299088-126299110 AAAAAGAATGTTTCCATACATGG - Intergenic
938178387 2:129157309-129157331 ATGGAAAATGTGTACAGACATGG - Intergenic
938596699 2:132794478-132794500 ACAAAAAATTTAGCCAGGCATGG + Intronic
938663373 2:133509675-133509697 ATGAAAACTGTCTCCAGACATGG - Intronic
938779081 2:134568369-134568391 ACAAAAAAATTACCCAGACATGG + Intronic
938894361 2:135735784-135735806 AAATAAAACGTGGCCAGACACGG - Intergenic
938902609 2:135810734-135810756 AAAAAAAATGTGGCCAGGCGTGG + Intronic
939002619 2:136753991-136754013 ACAAAACATTTGTCCTGAAAGGG - Intergenic
939015338 2:136897126-136897148 AAAAAAAATTTGTAGAGACAAGG + Intronic
939295145 2:140253617-140253639 TTAAAAAATATGTCCAGAGATGG + Intronic
939343094 2:140926513-140926535 AAAAAAAATCTGTACATACAGGG + Intronic
939998102 2:148938937-148938959 ACAAAAAAAGTAGCCAGGCATGG + Intronic
940150253 2:150592226-150592248 ACCAAAAATGTCTGGAGACATGG + Intergenic
940209411 2:151241178-151241200 ACAAAAAAATTAGCCAGACATGG + Intergenic
940215881 2:151303206-151303228 ACATAAAATGTGTCTGGAAAGGG + Intergenic
940785505 2:157976756-157976778 AAAAAAAATCTGGCCAGGCATGG - Intronic
941052192 2:160747635-160747657 ATAAAAAATGTCTGCAGTCATGG - Intergenic
941055634 2:160784821-160784843 AAAAAAAATCTGTAGAGACAGGG - Intergenic
941714274 2:168747277-168747299 AAAAAAAATTTGTTGAGACAGGG - Intronic
941813110 2:169773975-169773997 ACAAAAAAATTATCCAAACATGG + Intronic
942029383 2:171943856-171943878 AAAAAAAATTAGTCCAGGCATGG + Intronic
942261218 2:174165967-174165989 ACAAAAAAAGTAGCCGGACATGG + Intronic
943568413 2:189543647-189543669 AAAAAAAATCTGTCCACAGAAGG + Intergenic
943569360 2:189555011-189555033 ACAAAAAAACTAGCCAGACATGG + Intergenic
943594456 2:189839145-189839167 ACAAAAAAATTATCCAGGCATGG - Intronic
943708540 2:191062208-191062230 ATAAAAAATGTATCCAGGCATGG - Intronic
944558764 2:200914319-200914341 ACAAAAAATTTAGCCAGGCATGG - Intronic
944736548 2:202572018-202572040 AGGAAAAATGTGTCCTGAAATGG + Intergenic
945052977 2:205843086-205843108 AAACAAAATGTGTGCAGGCAAGG - Intergenic
945536822 2:211027423-211027445 AAAAAAAATTTGTAGAGACAAGG - Intergenic
945883829 2:215354017-215354039 AAAAAAAAAGTTTCCTGACAAGG - Intergenic
946663062 2:222021282-222021304 ACAAAAAAATTAGCCAGACATGG + Intergenic
946822658 2:223646364-223646386 ACAAGAAATCTATACAGACATGG - Intergenic
946847088 2:223868916-223868938 AAAAAAAATTTGTGGAGACAAGG - Intronic
946921959 2:224589856-224589878 ACAAAAAAAGGAGCCAGACATGG - Intergenic
946980221 2:225205112-225205134 ACAAAAAATTTAGCCAGACATGG - Intergenic
947257083 2:228179220-228179242 ACCAAAAATGTTTTCAGACTTGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
948415656 2:237801164-237801186 ACAAAAAAGTTATCCAGGCATGG + Intronic
1168903238 20:1383696-1383718 AAAAAAAATTTAGCCAGACATGG + Intronic
1169012294 20:2260622-2260644 ATAAAAAAATTATCCAGACACGG + Intergenic
1169114770 20:3057084-3057106 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1169166296 20:3427120-3427142 ATAAAAATTGAGGCCAGACATGG - Intergenic
1169199351 20:3700406-3700428 AAAAAAATTGTGGCCAGGCATGG - Intronic
1169212024 20:3771392-3771414 ACAAAAAAATTGGCCAGGCACGG - Intergenic
1169242705 20:3998148-3998170 ATAAAAAATGTGGCCAGGCGTGG + Intronic
1169372480 20:5038930-5038952 ACAAAAAAATTGGCCAGGCATGG - Intergenic
1169385722 20:5147692-5147714 AAAAAAAATGTGGCCAGACAGGG - Intronic
1169441456 20:5637202-5637224 AAAAAAAAAGTTACCAGACATGG - Intergenic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170671460 20:18438061-18438083 ACAAAAAAATTGGCCAGGCATGG + Intronic
1170700293 20:18697074-18697096 ACAAAAAAATTGTCCAGGCGTGG + Intronic
1171369315 20:24650989-24651011 ACAAAAAAACTAGCCAGACATGG - Intronic
1171474965 20:25401473-25401495 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1171528650 20:25836229-25836251 ACACAAAAATTGCCCAGACATGG + Intronic
1171548176 20:26019657-26019679 ACACAAAAATTGCCCAGACATGG - Intergenic
1171802794 20:29641661-29641683 AGAAGAAATGTATCAAGACATGG - Intergenic
1171946133 20:31379211-31379233 TAAAAAAATGTGTCCAGGCTGGG - Intronic
1172047089 20:32087795-32087817 ACAAAAAAATTGGCCAGGCATGG - Intronic
1172148286 20:32772860-32772882 AAAAAAAATGTGTCCAAACAGGG - Intronic
1172251637 20:33483662-33483684 CCAAAAAAAGTGGCCAGGCATGG + Intergenic
1172255510 20:33514054-33514076 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1172433139 20:34909210-34909232 AAAAAAAAGGTAGCCAGACATGG + Intronic
1172493688 20:35362510-35362532 ACAAAAAAATTATCCAGGCATGG - Intronic
1172552856 20:35815285-35815307 ACTCAAAATATGGCCAGACACGG + Intronic
1172668808 20:36619612-36619634 GAAAAAAATTTGTACAGACATGG - Intronic
1172747250 20:37221349-37221371 ACAAAAAAATTAGCCAGACATGG - Intronic
1172939994 20:38647544-38647566 ACAAAAAAATTATCCAGGCATGG - Intronic
1172953461 20:38738021-38738043 ATAAAAAAAGTAGCCAGACATGG - Intergenic
1173038237 20:39433699-39433721 GCAATAAATGTGTCCAGGCTTGG + Intergenic
1173238365 20:41269855-41269877 AAAAAAAATGTGTACATTCATGG - Intronic
1173587413 20:44193352-44193374 ACAAAAAAATTAGCCAGACATGG + Intergenic
1174250549 20:49216370-49216392 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1174290112 20:49502305-49502327 AAAAAAAATGTGGCCATGCATGG + Intergenic
1174300801 20:49580624-49580646 AAATAAAATATGTCCAGACCTGG + Intergenic
1174429126 20:50455387-50455409 AAAAAAAAAATGGCCAGACACGG - Intergenic
1174498722 20:50968486-50968508 AATCAAAATGTCTCCAGACATGG - Intergenic
1174565032 20:51458361-51458383 ACCAAGATTGTCTCCAGACAAGG + Intronic
1174680975 20:52407894-52407916 ACAAAAAAATTGGCCAGGCATGG - Intergenic
1174689223 20:52486633-52486655 AAAAAAAATTTATCCAGGCATGG - Intergenic
1174792472 20:53493132-53493154 ACAAAATCTGTGTTCATACATGG - Exonic
1174840268 20:53894734-53894756 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175661615 20:60817835-60817857 ACAGAAAATGTGTTTAGACCTGG + Intergenic
1175868008 20:62191695-62191717 ACAAAAGATGTGTACAGAAGGGG - Intronic
1176152637 20:63600196-63600218 ACAAAAAAATTGGCCAGGCATGG - Intronic
1176251404 20:64122248-64122270 ACAAAAAATGTAGCCAGGCGTGG + Intergenic
1176648826 21:9527932-9527954 ACAAAAAAAGTGTCCAGGCGTGG + Intergenic
1176650579 21:9543119-9543141 AAAAAAAATTTAGCCAGACATGG - Intergenic
1176765605 21:13015185-13015207 ACAAAAAAATTAGCCAGACATGG + Intergenic
1176948966 21:15021093-15021115 ACAAAAAATCTGTCTACAAATGG + Intronic
1177068365 21:16468576-16468598 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1177124099 21:17174248-17174270 ACAAAAAAAGTGTCAGGAAATGG + Intergenic
1177696512 21:24579970-24579992 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1177781354 21:25625655-25625677 ACAAAAAAATTAGCCAGACATGG + Intergenic
1177941265 21:27414560-27414582 ACAAAAAATGTGGTGAGAGAAGG - Intergenic
1178218676 21:30630305-30630327 ACAAAAAAATTAGCCAGACATGG - Intergenic
1178227556 21:30740792-30740814 AGAACACATGTGTCCAAACAGGG + Intergenic
1178284627 21:31315357-31315379 ACAAAAAAATTATCCAGGCATGG + Intronic
1178608092 21:34056664-34056686 ACAAAAAAATTAGCCAGACATGG - Intergenic
1178924453 21:36763178-36763200 ACACAAAAAGTAGCCAGACATGG - Intronic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1179389469 21:40974349-40974371 ACCAAAAGTGTATCCACACATGG + Intergenic
1179578975 21:42326747-42326769 AAAAAAAAAGTGGCCAGACATGG + Intergenic
1180289231 22:10781746-10781768 ACAAAAAATTTTTCCAAATATGG - Intergenic
1180603992 22:17041738-17041760 ACAAAAAAAATAGCCAGACATGG + Intergenic
1180916449 22:19491957-19491979 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1181312754 22:21954185-21954207 AAAAAAAATTTGTAGAGACAGGG + Intergenic
1181343814 22:22202858-22202880 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1181396128 22:22623770-22623792 ACAAAAAAATTATCCAGGCATGG - Intergenic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1182116043 22:27757049-27757071 AGGAAAAATGTGGCCAGGCATGG - Intronic
1182194728 22:28505099-28505121 ACAAAAAAAGTAGCCAGGCATGG + Intronic
1182386393 22:29945547-29945569 AAAAAAAATGTAGCCAGGCATGG + Intronic
1182497630 22:30721069-30721091 ACAAAAAAATTAGCCAGACATGG + Intronic
1182556105 22:31129218-31129240 AAAAAAAAGTTGGCCAGACACGG - Intronic
1182601247 22:31466120-31466142 ACAAAAATTGGGGCCAGGCACGG + Intronic
1182900533 22:33894677-33894699 ACCAGATATGGGTCCAGACAAGG - Intronic
1183156402 22:36078893-36078915 TCAAAAAAAGTTTCTAGACAAGG - Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183477791 22:38045563-38045585 ATAAAAAATAAGGCCAGACACGG + Intergenic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183830049 22:40413595-40413617 ACAAAAAATTTATCCGGGCATGG - Intronic
1183842767 22:40514101-40514123 ACAAAAAAATTAGCCAGACATGG + Intronic
1184161998 22:42702488-42702510 ACAAAAAAATTAGCCAGACATGG - Intronic
1184187684 22:42875825-42875847 ACAAAAAATTAGGCCAGGCATGG - Intronic
1184875453 22:47271774-47271796 AAAAAAAATGTGTCTAGGCCAGG - Intergenic
1184965869 22:47971790-47971812 ACAAAAAATAAATCCAGACTTGG + Intergenic
1185001205 22:48247236-48247258 ACAAAAAAATTAGCCAGACATGG + Intergenic
1185389458 22:50550944-50550966 ACAGAAAAAGGGCCCAGACAGGG - Exonic
949184597 3:1175076-1175098 ACACAAAATTTGGCCAGGCATGG + Intronic
949295528 3:2517840-2517862 ACAAATCATGTGTTCAAACATGG + Intronic
949447496 3:4150555-4150577 AAAAAAAATGTGTAGAGGCAGGG + Intronic
949822426 3:8130524-8130546 ATGAAAAATGAGTCCAGGCATGG + Intergenic
949979361 3:9491855-9491877 AAAAAAAATCTGGCCAGGCACGG + Intergenic
950164383 3:10782821-10782843 ACAAAAAATTTAGCCAGGCATGG + Intergenic
951231997 3:20189680-20189702 AAAAAAAATCTGTAGAGACAGGG + Intergenic
951478922 3:23139197-23139219 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
951848919 3:27116788-27116810 AAAAAAAATCTGGCCAGCCATGG - Intronic
951902178 3:27667603-27667625 AAAAAAAAATTGTCCAGACAGGG + Intergenic
951955095 3:28244571-28244593 ACAAAAAATTTAGCCAGGCATGG + Intronic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
952087483 3:29843552-29843574 ACAAAAAATGTATCGAGCCACGG + Intronic
952394930 3:32913025-32913047 AAAAAAAATGAGGCCAGGCACGG + Intergenic
952609917 3:35196045-35196067 AAAAAAAATGTTTCCAGGTAAGG - Intergenic
952796762 3:37245957-37245979 ACAAAAAATGTGGCCTGGTATGG + Intronic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953578649 3:44133839-44133861 CTAAAACATGTGTCCAGACCAGG - Intergenic
953762212 3:45697751-45697773 ACCAAATATCTGTCAAGACAAGG - Intronic
954341108 3:49954452-49954474 AAAAAAAATTTGTGAAGACAAGG + Intronic
954350076 3:50035913-50035935 ACAAAAAAATTAGCCAGACATGG - Intronic
954474856 3:50734756-50734778 ACAAAAAAATTAGCCAGACATGG - Intronic
955125980 3:56113172-56113194 AGAAAAATTGTGTTCATACATGG - Intronic
955246944 3:57233926-57233948 AGAAAAAAAGTAGCCAGACATGG + Intronic
955247014 3:57234451-57234473 ACAAAAAAATTATCCAGGCATGG - Intronic
955277850 3:57564974-57564996 AAAAAAAATGTGTGCTGACTGGG - Exonic
955303453 3:57806591-57806613 ACAAAAAAATTGGCCAGGCATGG - Intronic
955465517 3:59233031-59233053 ACAAAAATTGTGTCCTCACATGG - Intergenic
955525946 3:59819926-59819948 ACAAACACTGTGTCCTCACATGG - Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955740671 3:62088140-62088162 ACCTAAAGTGTTTCCAGACATGG - Intronic
955744952 3:62131257-62131279 ACGAAAAACGTCTCCAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
956038097 3:65117465-65117487 ACAAAAAAATTAGCCAGACACGG + Intergenic
956067846 3:65415787-65415809 ACCAATAATGTCTTCAGACAGGG - Intronic
956280426 3:67550500-67550522 ACAAAAAAAATTTCCAGGCATGG - Intronic
957074264 3:75589001-75589023 AAGTAAAATGTGTCCAGAAACGG - Intergenic
957205945 3:77198745-77198767 ACAAAAAAATTAGCCAGACATGG + Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
957386656 3:79504260-79504282 ACCAAAAATGTTTCCACAAAAGG - Intronic
957526615 3:81386353-81386375 ACCAAAATTGTGTTCAGAAAGGG + Intergenic
957528711 3:81412402-81412424 ACAGAAAATGTAGCCAGGCATGG - Intergenic
957534292 3:81481304-81481326 AAAAAAAAAATGTCCAGGCACGG - Intergenic
957827915 3:85473831-85473853 ACAAAAAAGTTGTACAGGCATGG - Intronic
959154776 3:102653508-102653530 ACAAACACTGTGTTCACACATGG - Intergenic
959443907 3:106413296-106413318 ACTAAAAATGTGTCAAGAGAGGG - Intergenic
959594152 3:108110919-108110941 ACAAAATCTGTGTCAAAACAGGG - Intergenic
959926927 3:111932624-111932646 AAAAAAAATGACTCCAGAAATGG - Intronic
960107566 3:113814497-113814519 ACAAAAAAATTGGCCAGGCATGG - Intergenic
960574595 3:119217685-119217707 ACAAAAAAATTAGCCAGACACGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
960839411 3:121941044-121941066 AAAAAAAATGCTTCAAGACAGGG - Exonic
961677526 3:128576757-128576779 AGGAAAAATGTGGCCACACAAGG - Intergenic
961697668 3:128717071-128717093 ACAAAAAATAAGGCCAGGCATGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
961974170 3:131005269-131005291 ACAAAAAAATTAGCCAGACATGG - Intronic
962221354 3:133566976-133566998 AAAAAAAATTTGGCCAGGCATGG - Intergenic
962229835 3:133653783-133653805 ACAAAAAAATTAGCCAGACATGG - Intronic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
962562001 3:136616111-136616133 ACAAAAAAAGTAGCCAGGCATGG + Intronic
962784985 3:138760075-138760097 ACAAAAAATTTAGCCAGGCATGG - Intronic
962786481 3:138772939-138772961 ACAAAAAAAGTAGCCAGGCACGG - Intronic
963181156 3:142357880-142357902 ACAAAAAAATTAGCCAGACATGG + Intronic
963288998 3:143467569-143467591 AAAAAAAATCTGTAGAGACAGGG - Intronic
963711308 3:148750787-148750809 ACCAAAAGTGATTCCAGACATGG - Intergenic
963898402 3:150710475-150710497 ACAAACACTGTGTCCTCACATGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964261262 3:154840353-154840375 ACAAAAAAAGTATGCAGGCATGG - Intergenic
964302354 3:155302820-155302842 ACAAAAAATTTCTCCAAACTTGG + Intergenic
964830936 3:160883912-160883934 AAAAAAAATCTATCCAGGCATGG + Intronic
965208008 3:165746845-165746867 ACAAAGAACGTTTCAAGACATGG + Intergenic
965481057 3:169220172-169220194 ACAAAAAAATTATCCAGGCATGG + Intronic
966446316 3:180005571-180005593 ACAAAAAAATTGGCCAGGCATGG + Intronic
966611207 3:181869707-181869729 AAAAAAAGTGTGGCCAGGCATGG + Intergenic
966657027 3:182370704-182370726 AAAAAAAATTTGTAGAGACAGGG + Intergenic
966825524 3:183961933-183961955 ACAAAAAAATTAGCCAGACATGG - Intronic
966827592 3:183978041-183978063 AAAAAAAATGTGGCCAGGCATGG - Intronic
967232208 3:187350606-187350628 ACCAAAACTGACTCCAGACAAGG + Intergenic
967750987 3:193116074-193116096 ACAAAAGATGTGTCCTCACATGG - Intergenic
967764274 3:193261071-193261093 ACAAAAAGTGTATGCAGACCAGG + Intronic
967803024 3:193685144-193685166 ACAAAAAAATTGGCCAGGCATGG + Intronic
967826346 3:193880652-193880674 ACAAAAAAAGTAGCCAGACATGG + Intergenic
967949136 3:194827175-194827197 ACAAAAAAAATAGCCAGACATGG - Intergenic
968122813 3:196137831-196137853 AAAAAAAATGTGGCCAGGCATGG + Intergenic
968409109 4:371020-371042 AAAAAAGATGTGGCCAGGCATGG - Intronic
968825067 4:2889666-2889688 ACAAAAAATTTGGCCAGGCATGG + Intronic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
969921163 4:10540922-10540944 ATAAAAAAAGTGGCCAGGCATGG + Intronic
969944409 4:10768533-10768555 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
970257974 4:14189142-14189164 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
970267650 4:14306748-14306770 TCACAAAAAGTGGCCAGACATGG - Intergenic
970333490 4:15006012-15006034 ACAAAAGATGGGTCTAGCCATGG + Intronic
970921856 4:21403811-21403833 ACAAATGCTGTGTCCACACATGG + Intronic
971224253 4:24736589-24736611 ACAAAAAAATTAGCCAGACATGG + Intergenic
971690308 4:29825499-29825521 ACAAAAACTATGGCCAGACGCGG - Intergenic
972297135 4:37750641-37750663 ACAAACACTGTGTCCTCACATGG - Intergenic
972505488 4:39716705-39716727 TTAAAAAATGAGGCCAGACACGG + Intronic
972603049 4:40589590-40589612 ACAAAAAAATTATCCAGGCATGG - Intronic
973560637 4:52131680-52131702 AAAAAAAAGGTGTCCAGGCACGG - Intergenic
973765883 4:54162103-54162125 ACAAAAAAATTATCCAGGCATGG + Intronic
974074076 4:57152972-57152994 ACAAAAAATTTAGCCAGGCATGG + Intergenic
974270155 4:59640271-59640293 ACAAAAAAATTGGCCAGGCATGG - Intergenic
974444979 4:61968228-61968250 TCAAAAAATGTCACCAGAAAAGG - Intronic
974455504 4:62124985-62125007 ACAAATGATGTGTGCAAACATGG + Intergenic
974639774 4:64613107-64613129 ACAAAGAATAAGTCTAGACAAGG + Intergenic
974703795 4:65486059-65486081 ACAAAAAGTCTGTCTGGACATGG - Intronic
975600346 4:76093269-76093291 ATAAAAAAAGTATCCAGGCATGG + Intronic
975737816 4:77398755-77398777 GCAAGAAATGTGTGCAGACCAGG - Intronic
975932743 4:79545397-79545419 AAAAAAAATTTGTAGAGACAGGG + Intergenic
975995514 4:80309268-80309290 ACACAAAAATTGTCCAGGCATGG - Intronic
976003008 4:80394390-80394412 AAAAAAACTGTGTACAGCCAAGG - Intronic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976474077 4:85462461-85462483 AAAAAAAATGGGGACAGACAAGG + Intergenic
976868287 4:89758213-89758235 ACAAAAAATTGGCCCAGACGTGG - Intronic
977315089 4:95436523-95436545 TCAAAAAAAGTGCCCAAACAAGG - Intronic
977709271 4:100106254-100106276 AAAAAAAAATTGTCCAGGCATGG - Intergenic
978074402 4:104511237-104511259 ACAAAAAAGGTGTGTACACAAGG - Intergenic
978262511 4:106777734-106777756 ACAAAAAATAAATCCAAACATGG + Intergenic
978271754 4:106899469-106899491 AAAAAAAATGTGTAGAGACAGGG + Intergenic
978414606 4:108462332-108462354 ACAATAAGTGAGTCCAGAAAAGG + Intergenic
978729105 4:112004019-112004041 ACAAAAAATGAGTGCAAATAAGG + Intergenic
978805587 4:112796638-112796660 AAAAAGAAGGTGGCCAGACATGG - Intergenic
979971904 4:127145916-127145938 AAAAAAAAAGTGTCCAGAAAAGG + Intergenic
980143285 4:128948178-128948200 ACAAAAAAAGTAGCCAGGCATGG + Intronic
980727068 4:136776549-136776571 ACAAACACTGTGTCCTCACATGG - Intergenic
980970331 4:139561198-139561220 AAAAAAAATGAGGCCAGGCACGG + Intronic
980974703 4:139599354-139599376 ACAAATAATGGGGCCAGGCAGGG + Intronic
981003774 4:139854111-139854133 AAAAAAAATGTGGCCGGGCACGG - Intronic
982190778 4:152853440-152853462 AGAAAAAAACTGTCCAGCCAAGG - Intronic
982651458 4:158092695-158092717 ACAAAAACTATGTCCACATAAGG + Intergenic
982720797 4:158857790-158857812 AAAAAAAATGTATCCGGGCATGG + Intronic
982726287 4:158910051-158910073 AAAAAAAATTTGTAGAGACAGGG + Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984006674 4:174319096-174319118 ACTAAAAATGTGGCCAAGCATGG - Intronic
984041311 4:174737665-174737687 ATACAAAATTTCTCCAGACATGG - Intronic
984059857 4:174978133-174978155 CCAAAAACTGTATCCAGAAAAGG + Exonic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
984528685 4:180889058-180889080 AAACTAAATGTGGCCAGACATGG + Intergenic
984536689 4:180984659-180984681 ACAAAACATTTGAACAGACAAGG - Intergenic
984685684 4:182665738-182665760 ACAAAAAATTTAGCCGGACATGG + Intronic
985225762 4:187760134-187760156 ACAAAAAAACTAGCCAGACATGG + Intergenic
985245811 4:187978790-187978812 AAAAAAAATGTGGCCAGACACGG + Intergenic
985260966 4:188114523-188114545 ACAGAAAATCTGGCCAGGCATGG + Intergenic
985942269 5:3146285-3146307 TCAAAATATGTGGCCAGGCATGG - Intergenic
986162016 5:5238803-5238825 ACAAGCAATGTGTCTACACAAGG - Intronic
986732554 5:10645906-10645928 ACCAAAAATGTCTACAGACGTGG - Intronic
986820088 5:11457227-11457249 AAAAAAATTGTGTAGAGACAGGG - Intronic
987102422 5:14604175-14604197 TAAAAAAATGTAGCCAGACATGG + Intronic
987164545 5:15181672-15181694 GCTAAAAATGTATTCAGACAAGG - Intergenic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987948857 5:24650809-24650831 GCAAGAAATGTGTGCAGACCAGG + Intergenic
988571302 5:32369654-32369676 AAAAAAAATGTAACCAGGCATGG + Intronic
988998005 5:36732847-36732869 ACAAAAAAATTAGCCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989372464 5:40723572-40723594 ACAAAAAAGGTGGCCAGATGCGG + Intronic
989468804 5:41790841-41790863 AAAAAAAATGTGTCCTCAAAGGG + Intronic
989590942 5:43112355-43112377 ACAAAAACTGCGTCCAGAATTGG + Intronic
990224609 5:53635227-53635249 CCAAAAAATCCATCCAGACATGG + Intronic
990306225 5:54496391-54496413 AAAAAAATTGTGGCCAGGCATGG - Intergenic
990579399 5:57153583-57153605 ACAAAAAAGGAGGCCAGGCATGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
990764323 5:59165427-59165449 ACAAAAAAATTAGCCAGACATGG - Intronic
991023703 5:62007699-62007721 ACACAAAATGTCTCTGGACACGG + Intergenic
991061719 5:62383215-62383237 AAAAAAAATCTGGCCAGGCATGG - Intronic
991081390 5:62604362-62604384 ACAAAAAAATTAGCCAGACATGG - Intronic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
992646142 5:78813028-78813050 ACAAATTATGTGTACAGAGATGG + Intronic
992880332 5:81102402-81102424 AAAATGAATGTGGCCAGACACGG + Intronic
992918507 5:81485799-81485821 AACACAAATGTGTCCAGGCATGG - Intronic
992934939 5:81693047-81693069 ACAAAAAAATTATCCAGACATGG + Intronic
993032082 5:82716185-82716207 AGAAAAAATGTCTAGAGACAGGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
993125922 5:83835527-83835549 ACAAAAAATTTAGCCAGGCATGG + Intergenic
993464367 5:88226947-88226969 AAAAAAAATTTGTAGAGACAGGG - Intronic
993668427 5:90730019-90730041 ACAAAAAAATTAGCCAGACATGG - Intronic
993749289 5:91647062-91647084 AGTGAAAATGAGTCCAGACAAGG - Intergenic
993788543 5:92176603-92176625 ACAAAAAATTTAGCCAGACGTGG + Intergenic
993927127 5:93880213-93880235 CCCAAAAATGTATCCTGACAAGG - Intronic
994040402 5:95252813-95252835 ACAAAAAAAGTATCTAGATAGGG + Intronic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994464991 5:100115649-100115671 ACAAAAAAGCAGTCCAGCCATGG + Intergenic
995733487 5:115272078-115272100 ACAAAAAAATTAGCCAGACATGG - Intronic
995792511 5:115906000-115906022 ACAAAAAAATTATCCAGGCATGG + Intronic
995918382 5:117279054-117279076 CCAAAAAATGTGTTAAAACATGG - Intergenic
996237773 5:121153706-121153728 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
996372480 5:122768134-122768156 TCAAGAAATGTGGCCAGGCATGG + Intergenic
996741505 5:126803399-126803421 ACAAAAAAATTATCCAGGCATGG - Intronic
997054908 5:130430546-130430568 AAAAAAAATGAATCTAGACACGG + Intergenic
997313692 5:132913935-132913957 ACAAGAAATTAGGCCAGACACGG + Intronic
997327020 5:133030062-133030084 ACAAAAAATTTAGCCAGGCATGG - Intergenic
997479092 5:134169709-134169731 ACAAAAAAATTGGCCAGGCATGG + Intronic
997484515 5:134218822-134218844 ACAAAAAATTTAGCCAGGCATGG - Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
997919697 5:137967233-137967255 ATAAAAAATATGGCCAGGCACGG + Intronic
997926711 5:138036826-138036848 ACCAAAAATGTCTGCACACATGG - Intronic
998181070 5:139943129-139943151 ATAAAAAGTGAGGCCAGACACGG - Intronic
998438868 5:142139062-142139084 ACAAAAAAAATAGCCAGACATGG + Intronic
998642149 5:144023035-144023057 ACAAACACTGTGTCCTCACATGG - Intergenic
998841353 5:146257970-146257992 ACAAAAAAATTAGCCAGACATGG - Intronic
999005693 5:147975023-147975045 ACAATAACTGTGTCCAAGCAAGG + Intergenic
999463758 5:151780666-151780688 ACAAAAAAACTGGCCAGGCATGG - Intronic
999999530 5:157124469-157124491 ACAAAAAATTTAGCCAGGCATGG + Intronic
1000221854 5:159222148-159222170 TTAAAAAATGTGTCCAAACACGG + Intergenic
1000375246 5:160574741-160574763 ACAAACACTGTGTCCTCACATGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1001044223 5:168359209-168359231 ACAAAAAAATTAGCCAGACATGG - Intronic
1001169486 5:169405185-169405207 GCAAAAAATGTGCAAAGACATGG + Intergenic
1001336357 5:170800608-170800630 ACAAAAAAGTTGTTCAGTCAAGG - Intronic
1001873765 5:175181598-175181620 ACAAGAAAAGAGTTCAGACAGGG - Intergenic
1002146150 5:177182926-177182948 ACAAAAAAAGAGGCCAGGCACGG - Intronic
1002316302 5:178346387-178346409 ACAAAAAAATTAGCCAGACATGG - Intronic
1002363576 5:178693155-178693177 ACAAAAAAATTAACCAGACATGG + Intergenic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1002474730 5:179458077-179458099 ACAAAAAAAGTAGCCAGACATGG - Intergenic
1002519182 5:179781603-179781625 AAAAAAAATTTGTAGAGACAGGG + Intronic
1002611412 5:180420948-180420970 AATAAAAAAGTGTCCAGGCACGG + Intergenic
1003346743 6:5276208-5276230 ACAATAAATCTTCCCAGACACGG - Intronic
1003797374 6:9619909-9619931 AAAAAAAATCTGGCCAGACACGG + Intronic
1003842030 6:10130605-10130627 ACAAAAAATTTAGCCAGACGTGG + Intronic
1003890254 6:10557661-10557683 AAAAAAATTTTGTGCAGACAGGG + Intronic
1004229289 6:13816609-13816631 ATAAAAATTATGTCCACACAAGG - Intergenic
1004338055 6:14782712-14782734 ACTAAAAATGTGTCCAGAATTGG + Intergenic
1004361212 6:14972882-14972904 ACAAATGCTGTGTCCACACATGG + Intergenic
1004491087 6:16117066-16117088 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004622621 6:17344308-17344330 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1004625114 6:17367690-17367712 ACAAAAAATGCATCCAGTCTAGG - Intergenic
1004836361 6:19536291-19536313 AAAAAAATTGTGGCCAGGCACGG + Intergenic
1004838938 6:19560588-19560610 ACAAAAAAGTTGGCCAGGCATGG + Intergenic
1004844715 6:19626851-19626873 ACAAAAAAATTAGCCAGACATGG + Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005896376 6:30182543-30182565 ACAAAAAAATTAGCCAGACATGG + Intergenic
1006219704 6:32478146-32478168 GCAAGAAATGTGTGCAGACCAGG - Intergenic
1006228983 6:32565906-32565928 GCAAGAAATGTGTGCAGACCAGG - Intronic
1006371763 6:33649056-33649078 ACAAAAAAATTAGCCAGACATGG - Intronic
1006471479 6:34231801-34231823 ACAAAAAACGTAGCCAGGCATGG - Intergenic
1006537719 6:34713464-34713486 ACAAAAAATGTAGCTAGGCATGG - Intergenic
1006643768 6:35502480-35502502 AAAAAAAATGTTGCCAGCCATGG - Intronic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007038138 6:38697066-38697088 ACAAAAAAATTAGCCAGACATGG - Intronic
1007500294 6:42291843-42291865 AGTAAAAACTTGTCCAGACAGGG - Intronic
1007587449 6:43000222-43000244 AAAAAAAAGGTGGCCAGACGTGG - Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1008059102 6:46978074-46978096 ACAAAAAATTTAGCCAGACATGG + Intergenic
1008202384 6:48606955-48606977 AGATAAAATGTATCCAGAAATGG - Intergenic
1008222091 6:48867495-48867517 TTAAAAAATTTGGCCAGACATGG + Intergenic
1008465428 6:51825063-51825085 AAATAAAGTCTGTCCAGACAGGG + Intronic
1009022164 6:57957283-57957305 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009408508 6:63337646-63337668 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1009438061 6:63640932-63640954 GCCAAAAATGTCTCTAGACATGG + Intronic
1010206866 6:73330319-73330341 AAAAAAAATTTAGCCAGACATGG + Intergenic
1010331670 6:74630168-74630190 AAATAATATGTGTCCAGAAATGG + Intergenic
1010508137 6:76685841-76685863 ACAAAAAATGTGTGCATTCAAGG - Intergenic
1010508862 6:76692519-76692541 ATAAAAAATTTAGCCAGACATGG + Intergenic
1011484897 6:87830835-87830857 ACAAAAAAATTATCCAGGCATGG - Intergenic
1011592789 6:88986509-88986531 AAAAGAAATGTGGCCAGGCATGG + Intergenic
1011600692 6:89057389-89057411 ACAAAAAAATTAGCCAGACACGG - Intergenic
1011962706 6:93111203-93111225 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012968659 6:105703175-105703197 ACAAAAAAATTAGCCAGACATGG - Intergenic
1013134905 6:107272691-107272713 ACTAAAAATGTGGCCAGGCGTGG + Intronic
1013510080 6:110836979-110837001 AGAAAAAATTTGTAGAGACAAGG - Intronic
1013743693 6:113319599-113319621 AAAAAAAATTTATCCAGGCATGG + Intergenic
1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG + Intergenic
1014786944 6:125630392-125630414 ACAAACACTGTGTCCTCACATGG - Intergenic
1015356696 6:132285862-132285884 AAAAAAAATGTGTAGAGATAGGG - Intergenic
1016002499 6:139056600-139056622 ACAAAAAAATTATCCAGTCATGG + Intergenic
1016176945 6:141090767-141090789 ACAAAAAATTTATGCAAACAAGG - Intergenic
1016383586 6:143510481-143510503 ACAAAAAAATTGGCCAGGCATGG + Intronic
1016720448 6:147290051-147290073 TTTAAAAATGTATCCAGACATGG + Intronic
1017464440 6:154681313-154681335 AAAAAAATTTTGTACAGACAAGG + Intergenic
1017508157 6:155087777-155087799 ATAAAAAATTTGTCCATACTGGG + Intronic
1017578915 6:155838781-155838803 ACAAAAAATGTTAGAAGACAGGG - Intergenic
1017745261 6:157441546-157441568 AGAAAAAATCTGGCCAGGCACGG + Intronic
1017826005 6:158082504-158082526 AAAAAAAAAGTAGCCAGACATGG + Intronic
1018272563 6:162096007-162096029 GTGAAAAATGTGTCCATACAGGG + Intronic
1018323362 6:162636964-162636986 AAAAAAGATGTGGCCAGGCATGG + Intronic
1018663124 6:166106981-166107003 ACAAAAAATCAGTAAAGACAGGG - Intergenic
1018675015 6:166213043-166213065 ACAAAAAAATTTTCCAGGCATGG + Intergenic
1018770670 6:166968821-166968843 ACAAAAAAATTAGCCAGACATGG - Intergenic
1019005100 6:168790158-168790180 ACTAAAAATGGGTCCTGCCACGG + Intergenic
1019271598 7:152201-152223 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1019531357 7:1505005-1505027 ACAAAAAAATTAGCCAGACATGG - Intergenic
1019844521 7:3484277-3484299 AAAAAAAATGTGTGTATACATGG - Intronic
1019904858 7:4054092-4054114 ACAAAAAAATTGGCCAGACGTGG - Intronic
1020021514 7:4872232-4872254 ACCAAAGATGTCTGCAGACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1020561448 7:9732595-9732617 ACAAAAAAATTGGCCAGGCACGG - Intergenic
1020723657 7:11781271-11781293 AAAAAAAATGTGCAGAGACAGGG - Intronic
1021120050 7:16788934-16788956 ACAGGAAATGTGTACATACAAGG - Intergenic
1021518155 7:21508794-21508816 AAAAAAAAAGTGTGTAGACAAGG - Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021900900 7:25284481-25284503 ACAAATAATGTGTCACGGCATGG + Intergenic
1021910687 7:25383347-25383369 AAGAAAAAGGTTTCCAGACAGGG - Intergenic
1022160339 7:27704109-27704131 TCATAAAATAAGTCCAGACATGG + Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022462422 7:30622943-30622965 ACAAAAAAATTGTCCGGGCATGG + Intronic
1022683322 7:32571074-32571096 ACAAAAAAATTAGCCAGACATGG + Intronic
1023001459 7:35811969-35811991 ACAAAAAAATTAGCCAGACATGG + Intronic
1023571377 7:41575937-41575959 ACAAAAAAGGTAGCCAGGCATGG - Intergenic
1023709542 7:42977088-42977110 ACAAAAATTATGTCAACACAGGG - Intergenic
1024035572 7:45505071-45505093 ACTAAAAATGGGGCCAGACCAGG + Intergenic
1024271224 7:47643376-47643398 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1025195388 7:56928376-56928398 AAAAAAAATGGGGCCAGGCATGG + Intergenic
1025275345 7:57578003-57578025 ACAAAAAAAGTGTCCGGGCGTGG + Intergenic
1025676564 7:63648566-63648588 AAAAAAAATGGGGCCAGGCATGG - Intergenic
1025697073 7:63783441-63783463 ACAAAAAAATTAGCCAGACATGG + Intergenic
1025705942 7:63864068-63864090 ACAAAAAAATTATCCAGGCATGG - Intergenic
1025970659 7:66321260-66321282 ACACAAAATGTTTCCAATCAAGG + Intronic
1025991341 7:66499394-66499416 ACAAAAAATTTAGCCAGACGTGG - Intergenic
1026041898 7:66875112-66875134 ACAAAAAAATTAGCCAGACATGG - Intergenic
1026310430 7:69178965-69178987 ACAAAAAATTTAGCCAGACATGG - Intergenic
1026376970 7:69761594-69761616 ACAGAAAATGTGACAGGACATGG + Intronic
1026411319 7:70126126-70126148 ACCAAATATGTGGCCAGGCATGG + Intronic
1027213592 7:76169242-76169264 ACAAAAAATTTAGCCAGACGTGG - Intergenic
1027615344 7:80416396-80416418 ACAAAAAAATTAGCCAGACATGG + Intronic
1027656747 7:80940153-80940175 ACAAAAAATGTCTCTAGATATGG + Intergenic
1027743260 7:82039870-82039892 ACATAAAATGAGTTCAGAGAGGG + Intronic
1027809757 7:82880592-82880614 ACCAAAAATGTTTCTAGACATGG - Intronic
1027974190 7:85128321-85128343 ACAAAAAATTTAGCCAGGCATGG - Intronic
1028104172 7:86857741-86857763 TCAAAATATGTTTTCAGACAAGG - Intronic
1028117392 7:87015495-87015517 ATGAAAAATCTGGCCAGACATGG + Intronic
1028256724 7:88608254-88608276 ACAAAAAAATTAGCCAGACATGG + Intergenic
1028891971 7:95998286-95998308 TCTAAAAATGTGGGCAGACATGG + Intronic
1028996225 7:97103429-97103451 ACAAAAGAAGTGTCAAAACAAGG - Intergenic
1029030479 7:97461395-97461417 ACAAAAAATTTGGCCGGGCATGG + Intergenic
1029119711 7:98259184-98259206 AAAAAAAATGTATAAAGACAAGG + Intronic
1029371196 7:100151873-100151895 AAAAAAAATGTGTGGAGACAGGG + Intronic
1029475643 7:100782482-100782504 ACAAAAAAATTATCCAGGCATGG - Intronic
1029517109 7:101031496-101031518 ACTGAAAATGTGTTCAGATAAGG - Intronic
1029613337 7:101639793-101639815 ACAAAAAATTAGCCCAGGCATGG + Intergenic
1029706378 7:102278434-102278456 ACAAAAAAAGTATCCGGGCATGG + Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030052063 7:105546718-105546740 ACAAAAAATTTAGCCAGGCATGG + Intronic
1030194813 7:106843134-106843156 ACAAAAAAATTAGCCAGACATGG + Intergenic
1030340341 7:108372373-108372395 ACAAAAAATCTGTACAGGAAAGG + Intronic
1030439284 7:109565996-109566018 AAAAAAAATAGGGCCAGACATGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1031273976 7:119694247-119694269 ACAAACACTGTGTCCTCACATGG - Intergenic
1031344941 7:120653187-120653209 AAAAAAAATGTAGCCAGGCATGG - Intronic
1031351990 7:120744104-120744126 ACAAAAAAATTAGCCAGACATGG + Intronic
1031421762 7:121561298-121561320 CCAAAAAAAGTGTCCAGGGAAGG - Intergenic
1031426084 7:121607428-121607450 ATAAAAAATTTAGCCAGACATGG - Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1032362022 7:131264992-131265014 ACAAAAAAATTAGCCAGACATGG - Intronic
1032611315 7:133418208-133418230 ACAAAAAAAGTGTCGAGTCTGGG - Intronic
1032715610 7:134506561-134506583 ACAAAAAAACTAGCCAGACATGG + Intergenic
1032829915 7:135612142-135612164 ACAGAATATATTTCCAGACAAGG + Intronic
1033080655 7:138294040-138294062 AAAAAAAAGGCGTCTAGACATGG - Intergenic
1033167890 7:139057183-139057205 AAAAAAAATGTTTCTAGAGATGG - Intronic
1034134955 7:148758461-148758483 ACAAAAAAAATATCCAGGCATGG + Intronic
1034609061 7:152348441-152348463 ACAAAAAAAGTAGCCAGGCATGG + Intronic
1035425112 7:158765578-158765600 ACAAAAAATTTAGCCAGGCATGG + Intronic
1035542990 8:456602-456624 AAAAAACGTGTGTACAGACAGGG + Intronic
1036117219 8:5971521-5971543 AAAAAAAAAGTATCCAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036510431 8:9395012-9395034 AAAAAAAAAATGTCCAGACAAGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037512260 8:19595623-19595645 AAAAAAAATCTGGCCAGACATGG + Intronic
1038323251 8:26548721-26548743 AAAAAAAAAGTCACCAGACATGG + Intronic
1038460811 8:27715073-27715095 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1038558214 8:28543725-28543747 AAAAAAAATGTATACAGTCATGG + Intronic
1038678655 8:29646543-29646565 AAGAAAAATTGGTCCAGACATGG + Intergenic
1038784068 8:30594565-30594587 AAAAAAAAAGTGGCCAGGCACGG + Intronic
1038788726 8:30647425-30647447 ACAAAAAAATTAGCCAGACATGG + Intronic
1039244096 8:35588885-35588907 ACAAAAAATTTAGCCAGACGTGG + Intronic
1039291718 8:36102362-36102384 ACAAAAAAACTAGCCAGACATGG + Intergenic
1039295300 8:36145062-36145084 ACAAAAAAATTATCCTGACATGG - Intergenic
1039962834 8:42262892-42262914 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1040010760 8:42659305-42659327 ACAGAAAATGTGGCCGGGCATGG + Intergenic
1040070502 8:43183455-43183477 AAAAAAAATGAGGCCAGGCATGG - Intronic
1040395275 8:46992951-46992973 ACAAAAAAATTAGCCAGACATGG + Intergenic
1040845845 8:51838312-51838334 AAAAAAAATTTGTAGAGACAGGG - Intronic
1041064074 8:54064259-54064281 ACAAAAAATTAGCCCAGGCATGG + Intronic
1041148980 8:54911984-54912006 AAAAAAAAAATGTCCAGGCATGG - Intergenic
1041272543 8:56123193-56123215 ACAAAAAAATTATCCAGGCATGG + Intergenic
1041299793 8:56398886-56398908 GCAAATATGGTGTCCAGACATGG - Intergenic
1042897790 8:73690171-73690193 ACAAAAAATTTAGCCAGACGTGG + Intronic
1043403202 8:79903890-79903912 ACAACGAATGTGTCCAGGGATGG + Intergenic
1043417999 8:80071333-80071355 GCAAAAAATGGGTACACACAAGG + Intronic
1043455239 8:80406095-80406117 AAAAAAAATCTGTAGAGACAGGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1043862687 8:85338867-85338889 ACAAAAAAATTGGCCAGGCATGG - Intronic
1044354877 8:91209271-91209293 ACAAAAAAATTAGCCAGACATGG + Intronic
1044572053 8:93731003-93731025 ATAAAAAATTTAGCCAGACAAGG + Exonic
1044683085 8:94801308-94801330 ACAAAAAAAGTAGCCAGACGCGG + Intergenic
1044872835 8:96637293-96637315 AGAAAAGATGTGTCAAGCCAAGG - Intergenic
1045000553 8:97874559-97874581 AAAAAAAATTTAGCCAGACATGG - Intronic
1045155422 8:99463846-99463868 ACAAAAAAATTAGCCAGACATGG - Intronic
1045334239 8:101184080-101184102 ACAAAAAATTTAGCCAGGCATGG - Intronic
1045587545 8:103555639-103555661 AGAAAAAATCTGGCCAGGCATGG + Intronic
1045690390 8:104754165-104754187 ACCAAAAATGTCTCCAGGCTGGG - Intronic
1045729234 8:105216187-105216209 ACAAACAATGTGTGCAGTTAAGG - Intronic
1046016415 8:108610639-108610661 AGAAAAAAAGTGTCCAGGCTGGG + Intronic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1046279774 8:112011527-112011549 ACTAAAAAAGTTTCCAGACATGG - Intergenic
1046784381 8:118250647-118250669 ATAAAAAATTTAGCCAGACATGG - Intronic
1046921090 8:119729551-119729573 TTAAAAAATATGTTCAGACAAGG + Intergenic
1046941456 8:119935428-119935450 AGAAAAAAGCTGGCCAGACACGG + Intronic
1047475373 8:125223200-125223222 ACAAAAAAATTAGCCAGACATGG + Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1047726647 8:127689766-127689788 TCAATAAATGTGTACAGACTGGG + Intergenic
1047978751 8:130158357-130158379 AAAAAAAAAGTATCCAGGCATGG + Intronic
1048503370 8:134998766-134998788 ACCAAAAGTCTTTCCAGACAGGG - Intergenic
1049281294 8:141747404-141747426 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1049629513 8:143645284-143645306 ACAAAAAAATTGGCCAGGCATGG + Intronic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1050668613 9:7969882-7969904 ACCAAAAATGTCTCTGGACATGG - Intergenic
1050919000 9:11175353-11175375 AAAAAAAATGTTACCAAACATGG + Intergenic
1051147792 9:14047319-14047341 ACAGAATATGTGACCAGAGATGG + Intergenic
1051212269 9:14757397-14757419 ACAAAAAAATTGGCCAGGCATGG + Intronic
1051427641 9:16949893-16949915 TCAGAAAATGTGGCCGGACATGG - Intergenic
1051838392 9:21366103-21366125 ACCAAAAATTTGGCCAGGCATGG - Intergenic
1051990573 9:23147094-23147116 AAAAAAAATCTGTCCAGATATGG - Intergenic
1052344712 9:27397922-27397944 CCAAAAAGTGTCTCTAGACATGG + Intronic
1052910475 9:33876758-33876780 ACAAAAAATGTAGCCGGGCATGG + Intronic
1052921918 9:33977816-33977838 ACAAAAAAATTATCCAGGCATGG - Intronic
1053162004 9:35819646-35819668 ACAAAAAATTTAGCCAGGCATGG - Intronic
1053251586 9:36578636-36578658 ATAAACAATGTTTCCATACAAGG - Intronic
1053326894 9:37161417-37161439 ACAAAAAAATTAGCCAGACATGG + Intronic
1053573688 9:39336144-39336166 ACAAAAAATTAGTCCAGGCGGGG + Intergenic
1053838309 9:42164703-42164725 ACAAAAAATTAGTCCAGGCGGGG + Intergenic
1054095255 9:60894829-60894851 ACAAAAAATTAGTCCAGGCGGGG + Intergenic
1054123456 9:61282865-61282887 ACAAAAAATTAGTCCAGGCGGGG - Intergenic
1054850194 9:69839714-69839736 AACCAAAATTTGTCCAGACATGG - Intronic
1055012478 9:71581943-71581965 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1055295438 9:74828198-74828220 ACAAAAAAATTGGCCAGGCATGG + Intronic
1055459693 9:76507419-76507441 ATAAAAAATTTCTGCAGACAAGG - Intergenic
1055461932 9:76527824-76527846 AGCAAAAATGTGTCCAGAATTGG + Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1056043477 9:82691810-82691832 AAAAAAAATTTGTAGAGACAGGG + Intergenic
1056108005 9:83366415-83366437 ACAAAAAAGTTATCCAGGCATGG + Intronic
1056206762 9:84326851-84326873 CCAAAAAATTTAGCCAGACATGG + Intronic
1056375485 9:86005880-86005902 AAAAAAAATCTGGCCAGGCATGG + Intronic
1056827209 9:89884560-89884582 ACACAGATTGTCTCCAGACAGGG - Intergenic
1056980177 9:91302612-91302634 ACAAAAAAATTAGCCAGACATGG + Intronic
1057289947 9:93799356-93799378 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1057330029 9:94105676-94105698 AAAAAAAAAGTGGCCAGGCATGG + Intronic
1057398832 9:94704354-94704376 AAAAAAAAAGTGGCCAGGCATGG - Intergenic
1057731313 9:97611271-97611293 ACAAAAAAATTAGCCAGACATGG + Intronic
1057953429 9:99388002-99388024 ACAAAAAAATTAGCCAGACATGG + Intergenic
1058046294 9:100360851-100360873 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1058050071 9:100396729-100396751 ACAAAAAAATTAGCCAGACATGG + Intergenic
1058143261 9:101380906-101380928 ACAAAAAAATTGGCCAGGCATGG - Intronic
1058221770 9:102312401-102312423 TCAAAAAATGTTTCCAGAAAGGG - Intergenic
1058412625 9:104749273-104749295 ACAAAAAGAGTGTCCACAAAAGG + Intronic
1058449383 9:105081781-105081803 ACAAAGAAAGTGTGCAGACTTGG - Intergenic
1058580221 9:106447766-106447788 ACAAAATATGTGTTCATAGATGG + Intergenic
1058647638 9:107145462-107145484 AGAAAAAATGTGGCCAAACGAGG + Intergenic
1058889420 9:109348168-109348190 AAAAAAAAATTGTACAGACAGGG - Intergenic
1058891929 9:109368699-109368721 AAAAAAAATTTATCCAGGCATGG - Intergenic
1059172068 9:112134775-112134797 AAAAAAAATGTGGCCAGGCACGG + Intronic
1059297543 9:113285329-113285351 AAAAAAAATTTGTAGAGACAGGG - Intronic
1059821641 9:117980152-117980174 GCACAAAATGTGTGCACACAAGG - Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060363936 9:122989876-122989898 ACACTAAAAATGTCCAGACAAGG - Intronic
1060621227 9:125068923-125068945 ACAAAAAATTTGACCAGGCGCGG + Intronic
1060637943 9:125214262-125214284 ACCCAAAATGTTTCCAGATATGG - Intronic
1060736305 9:126068497-126068519 ACAAAAAAAGAGGCCAGGCATGG - Intergenic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1060850582 9:126871941-126871963 AAAAAAAATTTGTAGAGACAGGG - Intronic
1061025512 9:128046310-128046332 ACAAAAAAATTAGCCAGACATGG + Intergenic
1061093063 9:128437610-128437632 AAAAAAAATGTGGCCAGGCATGG - Intergenic
1061223434 9:129266032-129266054 ACAAAAAATTTTTTGAGACAGGG + Intergenic
1061430040 9:130525020-130525042 ACAAAAAACTTAGCCAGACATGG + Intergenic
1061466206 9:130782212-130782234 ACAAAAAAATTGGCCAGGCATGG - Intronic
1061491299 9:130946026-130946048 ACACAAAATGTGGCCAGGCGTGG + Intergenic
1061696322 9:132376834-132376856 ATACAAAAAGTGTCCAGGCATGG - Intronic
1061701225 9:132417401-132417423 AGAAAAACTGCGGCCAGACATGG - Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1061958776 9:133977470-133977492 ACACAGAATGTTGCCAGACAAGG + Intronic
1062329675 9:136032860-136032882 ACAAAAAAATTACCCAGACATGG + Intronic
1203626562 Un_KI270750v1:31481-31503 ACAAAAAAAGTGTCCAGGCGTGG + Intergenic
1203628319 Un_KI270750v1:46672-46694 AAAAAAAATTTAGCCAGACATGG - Intergenic
1185473211 X:397538-397560 AAAAAAAAAAAGTCCAGACATGG + Intergenic
1185484290 X:470479-470501 ACAAAAAAAGAGGCCAGGCATGG - Intergenic
1185680528 X:1885126-1885148 AAAAAAATTGTTTCCAAACAGGG + Intergenic
1185744696 X:2563361-2563383 ACAAAAAATGTAGCCAGGCATGG - Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1185819255 X:3185864-3185886 TCACAAAATGTGTCCAGAGTTGG + Intergenic
1185822862 X:3221395-3221417 ATAAAAAATGTAGCCAGACATGG - Intergenic
1185839337 X:3374134-3374156 ACAAAACATGTGTCTGCACATGG + Intergenic
1185979422 X:4760111-4760133 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1186094571 X:6085682-6085704 ACATAAGCTCTGTCCAGACATGG - Intronic
1186101034 X:6156993-6157015 AGTAAAAATGTGGCCAGGCATGG + Intronic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186157369 X:6739467-6739489 ACCAAAAATGTCCTCAGACATGG - Intergenic
1186159257 X:6759578-6759600 ACCAAAAATGATTCCAGATATGG + Intergenic
1186162125 X:6788547-6788569 ACAAAAAAAGTAGCCAGGCATGG + Intergenic
1186239599 X:7552331-7552353 ACCAAGAATGTCTCCAGATATGG - Intergenic
1186515521 X:10163906-10163928 ACAAAAAATGTCTCTAGACATGG + Intronic
1186651001 X:11559770-11559792 ACAAAAAAAGTAGCCAGGCATGG + Intronic
1186959552 X:14720968-14720990 ACAAAAAAATTAGCCAGACATGG + Intronic
1187312982 X:18164176-18164198 ACAAAAAAAGTAGCCAGGCATGG - Exonic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1187755762 X:22524419-22524441 AGAAAAATTATGTCCTGACAGGG - Intergenic
1187911911 X:24119122-24119144 ACAAAAAATGTGTCTAGGCTGGG - Intergenic
1188269853 X:28125581-28125603 TTTAAAAATGTGTCCATACAGGG - Intergenic
1188490901 X:30738301-30738323 ACAAAAAAAGTAGCCAGGCATGG - Intergenic
1188645288 X:32559104-32559126 ACAAAAAAAGTAGCCAGGCATGG - Intronic
1188690349 X:33121384-33121406 ACAAAAAAATTAACCAGACATGG - Intronic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1189151325 X:38710269-38710291 AAAAAAAATGTGGCCAGGCCCGG - Intergenic
1189420952 X:40857172-40857194 ACAAAAAACTTGGCCAGCCATGG - Intergenic
1189448651 X:41106026-41106048 ACAAATAATGTATCCAGTAAGGG - Intronic
1190183088 X:48210288-48210310 TGAAAAAATGTGTTCAGGCATGG - Intronic
1190186659 X:48240534-48240556 TGAAAAAATGTGTTCAGGCATGG - Intronic
1190187531 X:48249146-48249168 TGAAAAAATGTGTTCAGGCATGG + Intronic
1190196305 X:48321682-48321704 TGAAAAAATGTGTTCAGGCATGG - Intergenic
1190201350 X:48364247-48364269 TGAAAAAATGTGTTCAGGCATGG + Intergenic
1190487105 X:50938709-50938731 ACCAAAAAATTATCCAGACATGG - Intergenic
1190656415 X:52616922-52616944 TGAAAAAATGTGTTCAGGCATGG + Intergenic
1190663019 X:52672050-52672072 TGAAAAAATGTGTTCAGGCATGG - Intronic
1190668187 X:52714738-52714760 TGAAAAAATGTGTTCAGGCATGG + Intergenic
1190671230 X:52743666-52743688 TGAAAAAATGTGTTCAGGCATGG - Intergenic
1190676404 X:52786432-52786454 TGAAAAAATGTGTTCAGGCATGG + Intronic
1190720608 X:53144398-53144420 ACAAAAAATCTGTCTAGGCTGGG + Intergenic
1190723869 X:53173658-53173680 AAAAAAAATTTGTAGAGACAAGG - Intergenic
1190782959 X:53616066-53616088 AAAAAAAATTTCTCCAGTCACGG - Intronic
1190814470 X:53917032-53917054 AAAAACAATGTGGCCAGGCACGG - Intergenic
1190948431 X:55118705-55118727 ACAATCAATGAGTGCAGACAGGG + Intronic
1191048515 X:56165574-56165596 ACAAAAAATCTGTCTGGGCACGG + Intergenic
1191139743 X:57104404-57104426 ACAAGAAATGTGTGCAGATCAGG + Intergenic
1191751030 X:64542915-64542937 ACAAAAAATGTGGCCAGGTTTGG + Intergenic
1192249543 X:69400129-69400151 ACAAACACTGTGTCCTCACATGG + Intergenic
1192769942 X:74178423-74178445 GCAAGAAATGTGTGCAGACCAGG + Intergenic
1193084842 X:77439712-77439734 AAAAAAAAAGAGGCCAGACATGG + Intergenic
1193094836 X:77536028-77536050 ACAAAAGATGTGGCCAGGCATGG - Intronic
1193103705 X:77644093-77644115 ACAAAAAATTTAGCCAGACATGG - Intronic
1193354438 X:80501242-80501264 ACAAAAAAATTGGCCAGGCATGG + Intergenic
1193484580 X:82071095-82071117 ACAGTTAATCTGTCCAGACATGG + Intergenic
1193562934 X:83042264-83042286 AAAAAAAAAGTTTCCAGGCATGG + Intergenic
1194001864 X:88439701-88439723 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1194633822 X:96319915-96319937 ACAAAAAATTTAGCCAGGCATGG - Intergenic
1195039513 X:101001389-101001411 ACAAAAAAATTTTCCAGGCATGG - Intergenic
1195641653 X:107182319-107182341 ACCAAAAATGTCTCCAGATTTGG + Intronic
1195765972 X:108297511-108297533 ACCAAAAATGTTCCCAGACATGG + Intronic
1195931802 X:110085453-110085475 ACAAAAAACCTGACCAGGCATGG - Intronic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196088364 X:111710850-111710872 ACAAAAAAATTAGCCAGACATGG - Intronic
1196124800 X:112085656-112085678 ACCAAAAATGCGTCCAGGCATGG + Intergenic
1196219416 X:113094833-113094855 ACAAAAAACATAGCCAGACATGG + Intergenic
1196219632 X:113097511-113097533 AAAAAAAATTTGTAGAGACAAGG - Intergenic
1196289192 X:113918459-113918481 TCAAAAAAGGTGGCCAGGCATGG - Intergenic
1196849224 X:119921995-119922017 ACAAAAAATGTAGCCGGGCATGG - Intergenic
1197016929 X:121636129-121636151 ACAAAAAAATTAGCCAGACATGG + Intergenic
1197658877 X:129148459-129148481 AAAAAAAATTTGTAGAGACAGGG + Intergenic
1198603423 X:138310130-138310152 AGAAAACATGTGCCCAGAGAAGG - Intergenic
1198605390 X:138331731-138331753 GCAAAAAATGAGACCACACATGG - Intergenic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199181650 X:144863210-144863232 ACAAATAATGTATCCATCCACGG + Intergenic
1200310813 X:155075362-155075384 ACAAAAAAGGTGTGGAGAAAGGG - Intronic
1201236469 Y:11916706-11916728 ACTAAACATGTGTCTACACATGG - Intergenic
1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG + Intergenic
1201260560 Y:12154887-12154909 TAAAAAAATGTGGCCAGGCATGG - Intergenic
1201503751 Y:14674854-14674876 ACATAAGCTCTGTCCAGACATGG + Intronic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201550991 Y:15216260-15216282 ATGAAAAATGTCCCCAGACATGG - Intergenic
1201552963 Y:15238043-15238065 ACCAAAAATGATTCCAGATATGG + Intergenic
1201630572 Y:16067705-16067727 ACAAAAAATTTAGCCAGGCATGG + Intergenic
1201708987 Y:16968593-16968615 TCAATAAATGAGTGCAGACATGG - Intergenic
1202075093 Y:21029516-21029538 GCAAGAAATGTGTGCAGACAAGG - Intergenic