ID: 1130776462

View in Genome Browser
Species Human (GRCh38)
Location 15:86989498-86989520
Sequence CATCTTAGCAGATTAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130776462_1130776468 8 Left 1130776462 15:86989498-86989520 CCCCCTTTTAATCTGCTAAGATG 0: 1
1: 0
2: 2
3: 17
4: 141
Right 1130776468 15:86989529-86989551 TTAAAATATTTTCTAAAATGAGG 0: 1
1: 1
2: 31
3: 239
4: 1658

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130776462 Original CRISPR CATCTTAGCAGATTAAAAGG GGG (reversed) Intronic
902843059 1:19087680-19087702 CATCTTAGGAGATTAACAAAAGG - Intronic
905439018 1:37981220-37981242 CATTTTATGAGAATAAAAGGAGG - Intronic
907824114 1:57999144-57999166 CATGATAGCAGATTAATAAGTGG - Intronic
908912341 1:69086762-69086784 CTCCTTAGCAGCTTCAAAGGGGG - Intergenic
910204977 1:84741002-84741024 CATTCTAGCATATTCAAAGGTGG - Intergenic
910591672 1:88933063-88933085 CATGGAAGCAGATTTAAAGGAGG - Intergenic
911793801 1:102052313-102052335 TATCATAGCAGATCAAAAGGGGG + Intergenic
916380572 1:164206359-164206381 GATCTTAGTAGAACAAAAGGTGG + Intergenic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
920722121 1:208397679-208397701 TATCTCAGCATATTAAAAGGTGG + Intergenic
922984119 1:229852702-229852724 CATCGTAGCAGGGTAAACGGAGG + Intergenic
923941119 1:238828558-238828580 CATGTTAATAGATTAAAATGGGG + Intergenic
1063584186 10:7336434-7336456 CATATGAGCAAATTAAAATGAGG + Intronic
1064503034 10:15995355-15995377 AATTTTACTAGATTAAAAGGTGG - Intergenic
1064708524 10:18097748-18097770 CATCTATGCTGATTAAGAGGAGG - Intergenic
1067745722 10:48934275-48934297 CTTTTTAGCACATTAAAATGAGG + Intronic
1068760565 10:60703928-60703950 CATCCTATCAGATCAAAAGCCGG - Intronic
1079489370 11:20970423-20970445 GAGCTTAACAGTTTAAAAGGGGG + Intronic
1079673042 11:23191117-23191139 CATATTAGCAGATTATAATGTGG - Intergenic
1079968412 11:27006614-27006636 CATCTTTGCAGATGGACAGGAGG + Intergenic
1081490641 11:43565768-43565790 CATCTTAGAAAATGAAAAAGAGG + Intronic
1081653961 11:44844929-44844951 CACCATTGCAGATTCAAAGGAGG + Intronic
1083339548 11:61950217-61950239 CTTCTGAGCAGATTACAAGAAGG + Intronic
1087066170 11:94029943-94029965 CCTCTTAGCAGATTAAAAGCAGG + Intronic
1088594582 11:111430946-111430968 CTTTTTACCAGATTAAAAGAAGG + Intronic
1089021039 11:115215303-115215325 CATCTTTCCAGAATCAAAGGTGG - Intronic
1089408148 11:118215966-118215988 CCTCTTAGCAGATTCTGAGGTGG - Intronic
1089883922 11:121801176-121801198 GAGCTCAGCAAATTAAAAGGAGG - Intergenic
1091092033 11:132780391-132780413 CACCTTAGCATATTAATAGTGGG + Intronic
1092491319 12:8948546-8948568 AATTGTAGCATATTAAAAGGGGG - Intronic
1099570128 12:84306569-84306591 CATCATAACAGTTTAAGAGGCGG - Intergenic
1102640835 12:114365120-114365142 CAGCTTAGTAGATTTAAATGGGG + Intronic
1108784886 13:53886399-53886421 TATTTTACCAGATGAAAAGGTGG + Intergenic
1109590279 13:64470642-64470664 CATGGTAGTTGATTAAAAGGAGG - Intergenic
1110177107 13:72569887-72569909 CAGCTCAGCAGAATAACAGGTGG + Intergenic
1116279909 14:42891483-42891505 CATCTCAGAAGATGAAAAGTTGG + Intergenic
1119663587 14:76468086-76468108 CATGTCAGGAAATTAAAAGGAGG + Intronic
1122485977 14:102080167-102080189 AAACTTAGCAGAATAAAATGGGG + Intergenic
1125153016 15:36554944-36554966 CATATTAGTAGAATAAAAGGGGG + Intergenic
1126259743 15:46674682-46674704 CATTTTAACAGAATAAAAGTAGG + Intergenic
1130776462 15:86989498-86989520 CATCTTAGCAGATTAAAAGGGGG - Intronic
1130843056 15:87719826-87719848 CATCCTAACAGAGGAAAAGGTGG + Intergenic
1133876020 16:9735347-9735369 AATCTTAGAAGATTAAATGCAGG + Intergenic
1144423421 17:15118491-15118513 CATCTTAGAAGAGTAGAAGGTGG - Intergenic
1145858568 17:28186670-28186692 GATCTGACCAGATTAAAAAGGGG - Intronic
1153301984 18:3599302-3599324 CAATTTTGCAGATGAAAAGGAGG + Intronic
1153734431 18:8050097-8050119 CTTTTTGGCAGATTAAAAGGTGG + Intronic
1155813207 18:30266411-30266433 CATTTTAGCAGAAGAAAGGGTGG - Intergenic
1155930559 18:31703161-31703183 CATCTTAGCTGAAGAAAGGGAGG + Intergenic
1156928805 18:42616342-42616364 GATCTGAGTAGATTAAAGGGAGG + Intergenic
1157007857 18:43607373-43607395 CATCATAGTAGATTAAATGGTGG + Intergenic
1167858998 19:52268083-52268105 AATATTAGCAGGTTAAAATGAGG - Intergenic
1168493434 19:56830419-56830441 ATTCTTAGCAGAGTAAAAGCAGG + Intronic
926896925 2:17702137-17702159 CATCTTAGCATTTTAAATGATGG + Intronic
929812566 2:45203270-45203292 AATCTTATCAGATCAAAAGGGGG + Intergenic
933473922 2:82765049-82765071 CATAATAACAGAGTAAAAGGTGG + Intergenic
938072165 2:128314501-128314523 CATCTGAGCAGACTGAAGGGAGG + Intronic
939378991 2:141409834-141409856 TATTTTAGCAGAATAAAAGAAGG + Intronic
940198412 2:151122784-151122806 CACCTTACCAGCTTCAAAGGAGG + Intergenic
941110549 2:161415659-161415681 TATGTTTGCAGTTTAAAAGGTGG + Intergenic
942389791 2:175479896-175479918 CATCTGGGCAGATTAACAGGTGG + Intergenic
943542212 2:189230636-189230658 CATCTTAGCATCTTATGAGGTGG - Intergenic
943612956 2:190056137-190056159 CAAATTAGCAGATTAAATAGTGG - Exonic
947154150 2:227144744-227144766 CTTCTTGGCTGATTAAAAAGAGG - Intronic
1170179548 20:13514180-13514202 CATCTTAGCAGATTTCAATTGGG + Intronic
1170787853 20:19482922-19482944 CAGCTTAGCAGATGGGAAGGTGG + Intronic
1171182676 20:23102449-23102471 CCTCTTAGCAGGTTCAGAGGTGG + Intergenic
1172128146 20:32637477-32637499 CATCTGAGCAGATTTGAAGGAGG - Intergenic
1172612865 20:36264778-36264800 CATCTTAGGAGTTTTACAGGGGG - Intronic
1174101121 20:48127078-48127100 CATGTTAGAAGATTTTAAGGAGG - Intergenic
1179466399 21:41577604-41577626 CAAGTAAGCAGAGTAAAAGGAGG - Intergenic
1181320532 22:22002405-22002427 CAAATTAACAGATTAACAGGGGG - Intergenic
952047819 3:29345404-29345426 CATTCTAGCAGTTTAAAAGGAGG + Intronic
952898236 3:38093412-38093434 CATCTTTGAAGACCAAAAGGAGG - Intronic
954591238 3:51784572-51784594 CATATTAACAGACTAAAGGGGGG - Intergenic
954816294 3:53283826-53283848 CATCTTAGCATTTTAAATGAAGG + Exonic
956143788 3:66172155-66172177 AATCTTAGCACTTTAGAAGGTGG + Intronic
957173930 3:76779382-76779404 CATCTTAGCAAATTTTAAGTTGG + Intronic
957535422 3:81496536-81496558 CATACTTGCAGACTAAAAGGAGG - Intronic
960713406 3:120553436-120553458 CATTTTAGCATATGAAAAGAGGG + Intergenic
963430072 3:145189837-145189859 CTTCTTAGCAGAATGAAAGCAGG + Intergenic
963803949 3:149704231-149704253 GATTTTAACAAATTAAAAGGGGG + Intronic
965100984 3:164296964-164296986 CATCTTAAAAGATTAAAGTGGGG + Intergenic
966059355 3:175735556-175735578 CATCATTGCAGAATACAAGGAGG + Intronic
968426905 4:530000-530022 CAACTGAGCAGATTTAAAGAAGG - Intronic
970807918 4:20057435-20057457 CAGCTTATGAGATTAAAAAGGGG + Intergenic
975057956 4:69958986-69959008 CATCTGTAAAGATTAAAAGGAGG + Intronic
975225690 4:71869063-71869085 CAGCTTAACATATTAAATGGTGG - Intergenic
977332970 4:95661251-95661273 TATCTTGGCAGATCAAATGGTGG - Intergenic
979252971 4:118584730-118584752 CATCTTAACAGATCTTAAGGAGG - Intergenic
979575854 4:122291690-122291712 CATCTTAGAAGCATATAAGGAGG + Intronic
979997752 4:127452755-127452777 CATTTGAGTAGATTAAAAGAGGG + Intergenic
980142673 4:128939318-128939340 CATATTTGCAGATTGAATGGTGG + Intronic
981797432 4:148612494-148612516 TATATTAGGAGATTTAAAGGAGG + Intergenic
983382902 4:167020427-167020449 CATTTTGGCATATTAAAAGATGG + Intronic
983743916 4:171170218-171170240 CATCTTAGAAGATTAAGTGAGGG - Intergenic
984557435 4:181231865-181231887 GATCTTAGTAGATTAATAGTTGG + Intergenic
990952870 5:61315303-61315325 CATACTAGCAGATTATAAAGAGG - Intergenic
991170572 5:63620196-63620218 CATCTTAACAGATTAAGAGCAGG + Intergenic
994104989 5:95937596-95937618 CACCTTAGTAAATTAACAGGTGG + Intronic
994456302 5:100012597-100012619 CCTCTTAGCAGATTAAAAAGTGG + Intergenic
994537618 5:101050931-101050953 TATCTTAGCACATTAAAGTGAGG - Intergenic
995362698 5:111316434-111316456 CATCTTAGAAGAAGAAAAGAAGG - Intronic
995688823 5:114800556-114800578 CATTTTTGCAGCTGAAAAGGTGG - Intergenic
995801121 5:115996535-115996557 CACATTACTAGATTAAAAGGAGG - Intronic
996969452 5:129346020-129346042 CCTGTGAGCAGATTTAAAGGAGG + Intergenic
997371607 5:133364905-133364927 AATCTAAGGAGATTAAGAGGGGG - Intronic
999878608 5:155836215-155836237 CATCCTAGCAAATTCAATGGTGG - Intergenic
1000055289 5:157600801-157600823 CATCTTAAAAAATAAAAAGGTGG - Intergenic
1001095493 5:168772647-168772669 CATCTTTGCAAATTAAATTGGGG - Intronic
1003081521 6:3025241-3025263 AATCCTAGCACTTTAAAAGGAGG + Intergenic
1003312813 6:4984163-4984185 AATCTTAGCTCCTTAAAAGGAGG + Intergenic
1005727049 6:28659560-28659582 CATATTAGAGGATTAAAAGAGGG + Intergenic
1006593207 6:35173296-35173318 CATCCTGGCAGATAAAGAGGTGG - Intergenic
1008530900 6:52457532-52457554 TATCTTAGCTACTTAAAAGGAGG - Intronic
1009524111 6:64721367-64721389 TATCTGAGCAAATAAAAAGGAGG + Intronic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1014676268 6:124370384-124370406 CATCTTAGAAGGGTAAAAAGAGG + Intronic
1016101093 6:140101175-140101197 CCTCTTAGCAGATCTGAAGGGGG + Intergenic
1016765100 6:147783877-147783899 CATCTTAGTGGATTAAGAGGTGG + Intergenic
1019272461 7:158000-158022 CAGCTTTGCAGATAAAAAGGAGG - Intergenic
1020157477 7:5738130-5738152 CACCTCTGCAGATTAGAAGGAGG + Intronic
1021185961 7:17565217-17565239 CATCTTATGAGATAAACAGGAGG - Intergenic
1021408410 7:20301067-20301089 AATTTTAGCAGAGTAAAAGTGGG - Intergenic
1022149693 7:27588663-27588685 CATCTTAGCAGAGAATAAGATGG - Intronic
1023734622 7:43223896-43223918 CATTTTTGCAGATTTGAAGGAGG - Intronic
1024448600 7:49512390-49512412 CATCTTAGCAGATTATAGTGAGG - Intergenic
1025796754 7:64745198-64745220 GATGTTAACACATTAAAAGGAGG - Intergenic
1026385661 7:69845235-69845257 CATCTTCTCTGATAAAAAGGAGG - Intronic
1028135793 7:87221472-87221494 TATCTTAGAAGATTGAATGGCGG + Intergenic
1030467192 7:109917836-109917858 GATCTTAGCATATTAAAATGTGG + Intergenic
1030592440 7:111498937-111498959 CATTCTGGCAGATAAAAAGGGGG + Intronic
1031602082 7:123722454-123722476 CATCTTAGATGATTAAAAGAAGG + Intronic
1033007771 7:137586118-137586140 CATATGAGCAGATAAAAAGTTGG + Intronic
1034561400 7:151881695-151881717 CATGTTAGCACATTGAATGGGGG + Intergenic
1036234348 8:7025340-7025362 CAACTGAATAGATTAAAAGGAGG - Intergenic
1039854194 8:41398421-41398443 CCTCTTTGCAGTTTAAAAAGGGG - Intergenic
1041798166 8:61769299-61769321 CTTTTTAGCAGAGCAAAAGGTGG - Intergenic
1043157184 8:76797961-76797983 CATCTTAGAAGACTAAAATATGG - Intronic
1043307492 8:78814537-78814559 AATCTTAGCAGATCAAAAACAGG - Intergenic
1045913747 8:107441776-107441798 GGTCTTTGCAGATTAAAAAGGGG + Intronic
1047663778 8:127067230-127067252 CTTCTTATCAGATTAAAATCAGG - Intergenic
1048607548 8:135985217-135985239 CAAGTCAGCAGATTTAAAGGTGG - Intergenic
1051877567 9:21807714-21807736 CTGCTCAGCAGAGTAAAAGGAGG + Intronic
1051934331 9:22426788-22426810 CATATTAGCAGAGTTGAAGGAGG + Intergenic
1052351353 9:27461508-27461530 TATCTTTGAAGATTAAAATGAGG - Intronic
1054862053 9:69964208-69964230 CATCTTTGCATTTTAAAAGAGGG + Intergenic
1056640284 9:88364333-88364355 CATATTAGCAGGTTAAAGAGAGG + Intergenic
1189691556 X:43622764-43622786 CATAATAGCAGATTTAAAGCAGG + Intergenic
1192413585 X:70956829-70956851 CATATCAGCAAATCAAAAGGTGG + Intergenic
1194184451 X:90756618-90756640 CATCTTAAAAGATAAAAAAGAGG + Intergenic
1194333849 X:92619816-92619838 CAGCCTAGAAAATTAAAAGGAGG + Exonic
1196899182 X:120366551-120366573 CTACTTAGCAGATGAAGAGGAGG + Exonic
1197265550 X:124366094-124366116 AATCTTAGCATATCAAAAGTAGG + Intronic
1199413724 X:147555709-147555731 AATCTGAGCACATTCAAAGGAGG - Intergenic
1199577171 X:149323606-149323628 CACCATAGCAGACTAGAAGGAGG + Intergenic
1200422456 Y:2986075-2986097 CATCTTGGGAGATTAAGATGGGG - Intergenic
1200531040 Y:4338531-4338553 CATCTTAAAAGATAAAAAAGAGG + Intergenic
1200642535 Y:5738818-5738840 CAGCCTAGAAAATTAAAAGGAGG + Intronic
1200804393 Y:7417988-7418010 CATCTTAGCATTTTAAATGAAGG + Intergenic
1201734988 Y:17249686-17249708 CTTCTCAGCACATTAAAAGTAGG - Intergenic