ID: 1130779182

View in Genome Browser
Species Human (GRCh38)
Location 15:87016899-87016921
Sequence AGTCCCTGCAGAGCAGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 272}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130779177_1130779182 21 Left 1130779177 15:87016855-87016877 CCCATACCACCAAGGCCTTGGGT 0: 1
1: 8
2: 206
3: 752
4: 978
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272
1130779179_1130779182 15 Left 1130779179 15:87016861-87016883 CCACCAAGGCCTTGGGTCTGATA 0: 1
1: 15
2: 49
3: 92
4: 259
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272
1130779173_1130779182 30 Left 1130779173 15:87016846-87016868 CCTTCTAAGCCCATACCACCAAG 0: 1
1: 0
2: 0
3: 17
4: 181
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272
1130779180_1130779182 12 Left 1130779180 15:87016864-87016886 CCAAGGCCTTGGGTCTGATACAG 0: 1
1: 0
2: 16
3: 67
4: 264
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272
1130779181_1130779182 6 Left 1130779181 15:87016870-87016892 CCTTGGGTCTGATACAGAGAGCT 0: 1
1: 20
2: 49
3: 89
4: 297
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272
1130779178_1130779182 20 Left 1130779178 15:87016856-87016878 CCATACCACCAAGGCCTTGGGTC 0: 1
1: 7
2: 103
3: 192
4: 311
Right 1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG 0: 1
1: 0
2: 4
3: 31
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130779182 Original CRISPR AGTCCCTGCAGAGCAGCCAC TGG Intronic
900205560 1:1430700-1430722 AGACCCTGCCCAGCAGCCAAGGG - Intergenic
900665927 1:3815513-3815535 TTTCCCTGCAGAGCAAGCACAGG + Exonic
900714094 1:4133106-4133128 AGCCCATGCTGGGCAGCCACTGG - Intergenic
901472698 1:9468592-9468614 AGTCCTTCCAGGTCAGCCACGGG + Intergenic
901474950 1:9483090-9483112 AGTCCCTGCAGGGGAGCCATGGG + Intergenic
902580270 1:17403630-17403652 ATTGCCTGCATAGCAGACACGGG + Intergenic
903495216 1:23761695-23761717 AATGGCTGCAGAGCAGACACAGG + Exonic
903667989 1:25019399-25019421 AGCCCCTGCAGAGTGGCCCCTGG - Intergenic
903925187 1:26826818-26826840 AGTACCAGCAGATCAGCCCCGGG + Exonic
904426430 1:30426536-30426558 TGTCTCTGCAGAGCAGCTAGAGG + Intergenic
904575711 1:31503921-31503943 AGTCCCTGCAGGGCAGGGAAGGG - Intergenic
905480970 1:38261743-38261765 AGTTCCAGCAGAGCAGCCCCTGG - Intergenic
905895226 1:41541410-41541432 AGTCACTGGAGGGCAGCCATGGG - Intronic
906544785 1:46613333-46613355 AGCCCCTGGACAGCAGCCCCAGG - Exonic
906923612 1:50090884-50090906 AGTCCCTGCACCGCAGTCAGAGG + Intronic
906938721 1:50237055-50237077 AGTCCCTCCAGTGCAGACCCTGG + Intergenic
907480648 1:54743551-54743573 AGTCCTTGCAGACAAGCCAGAGG + Intergenic
908315457 1:62927944-62927966 AGTCCTTGGAGAGAAGCCAGGGG + Intergenic
910754459 1:90672601-90672623 GCTCCCTGGAGAGCAGCCAAGGG - Intergenic
912843157 1:113057201-113057223 AGTTCCAGCTGACCAGCCACTGG - Intergenic
912935773 1:114002645-114002667 TGCCCCTGCAAAGCTGCCACTGG + Intergenic
915331452 1:155115223-155115245 AGTCCCAGCACAGCAGCCCCAGG - Intergenic
915528271 1:156489251-156489273 ATGCCCTGCAGCCCAGCCACAGG - Intronic
915894430 1:159800487-159800509 AGTCCCTGCAGGGCAGCAGCTGG - Intergenic
916023325 1:160813625-160813647 TGTCCCTGCAGAGCAGCTGCAGG + Exonic
918311631 1:183289437-183289459 AGTCTCTGCAGCCCGGCCACAGG + Intronic
920380150 1:205530447-205530469 AGCCCCAGCAGAGCAGCCCCGGG + Intronic
922753977 1:228083834-228083856 AATTCCTGCAAAGCAGCAACTGG - Intronic
922987260 1:229875343-229875365 AAGCCCTGCAGAGCTGCCACGGG + Intergenic
1062953178 10:1521058-1521080 AGTCCCTGAAGGGCAGCCTCAGG - Intronic
1063202038 10:3793331-3793353 AGTGCCTGGAGAGCAGGTACAGG - Intergenic
1069053207 10:63815993-63816015 AGTTTCAGCAGAGCAGCCGCTGG - Intergenic
1070590563 10:77797726-77797748 AGTGACTGCAGAGCAGGCACAGG + Intronic
1070649525 10:78224879-78224901 AGGCCCTGCAGAGCAGAGCCTGG - Intergenic
1072286770 10:93923592-93923614 ATTTCCTGCAGGGCAGCCCCCGG - Intronic
1073046880 10:100644618-100644640 TGTCCCTGCAGAGCCTCCTCTGG - Intergenic
1073100441 10:101003724-101003746 CGTCCCTGATGGGCAGCCACTGG - Exonic
1076614842 10:131748413-131748435 GGGCCCGGCACAGCAGCCACGGG + Intergenic
1076635533 10:131880035-131880057 CCTCCCTGCAGACCAGCCTCCGG - Intergenic
1077288513 11:1778205-1778227 AGTCCTTGCAGCAGAGCCACAGG + Intergenic
1079437720 11:20474517-20474539 AGTCCTGGCAGAGCAGCCGCTGG - Intronic
1083253818 11:61484581-61484603 AGTATCTGCAGAGCAGCCAGAGG - Intronic
1083619392 11:64041492-64041514 ACACCCTCCAGAGCAGCCCCGGG - Intronic
1084272424 11:68036410-68036432 AGGCCCTGCTGAGGAGCCTCAGG - Intronic
1087200217 11:95337641-95337663 AGCCCGTGGCGAGCAGCCACCGG - Intergenic
1088725784 11:112633405-112633427 TGTCCCTGCCTAGAAGCCACTGG + Intergenic
1088763065 11:112950249-112950271 AGTGCCTGAACAGCAGCCATGGG + Intergenic
1089553731 11:119302654-119302676 GGTTGCTGCAGAGCAGCAACTGG + Exonic
1089989728 11:122847997-122848019 AGTATCTGAGGAGCAGCCACAGG + Intronic
1091059586 11:132449076-132449098 GGTCCCTGCAGAGCTGGCCCAGG + Intronic
1091144443 11:133265337-133265359 AGACCCTGCAGAGCAGAACCTGG - Intronic
1094646375 12:32328488-32328510 AGTCCCTGCTGAGCACCAAACGG + Exonic
1095487800 12:42702717-42702739 TGTCCATGCAGAGCAATCACTGG - Intergenic
1099897290 12:88664552-88664574 GGTCCCTTCAAAGCAGCCCCAGG - Intergenic
1101166736 12:102044104-102044126 AGCCACTTCAGAGCAACCACAGG - Exonic
1103570787 12:121843466-121843488 AGTCTCTGTAAAGCAGCCCCAGG + Intronic
1104521550 12:129480402-129480424 AGTCCCAACACAGCAGCCAGAGG - Intronic
1106083471 13:26519742-26519764 TTGGCCTGCAGAGCAGCCACTGG - Intergenic
1106918002 13:34536046-34536068 AGTCCCTGCAGGTCAAACACAGG + Intergenic
1107986655 13:45781984-45782006 AGTGTCTGGAGAGCAGCCAGAGG + Exonic
1112783402 13:102926382-102926404 ACTCCCAGCACAGCAGCCAGAGG - Intergenic
1113030544 13:105989459-105989481 AGTCACTGTAAAGCAGCCTCAGG - Intergenic
1113680586 13:112241406-112241428 CCTCCCTCCAGAGCAGCCCCAGG + Intergenic
1113721509 13:112561252-112561274 AGTCCCTGCAAGCCAGCAACAGG + Intronic
1113994270 14:16053588-16053610 CTCCCCTGCAGAGCAGCGACCGG + Intergenic
1115796083 14:36937131-36937153 AGTTGCTGCAGTGCAGCCTCAGG - Intronic
1117552395 14:56849371-56849393 GCTCCCTCCTGAGCAGCCACAGG - Intergenic
1119205705 14:72792049-72792071 AGTGACTGCTGAGCAGCCAGGGG + Intronic
1120155865 14:81092565-81092587 AGTCCCTGAAAAGCATTCACAGG - Exonic
1120761847 14:88292274-88292296 AGACACTGCAGATCAGCCATGGG - Intronic
1121218550 14:92267224-92267246 TGTCCCAGCAGAGGAGCCTCAGG - Intergenic
1121610343 14:95274394-95274416 TGCCCATGCACAGCAGCCACAGG + Intronic
1122152650 14:99733118-99733140 AGTCACTGCAGAGCCTCCCCTGG + Intergenic
1122705328 14:103617185-103617207 TTTCCCTGCAGAACAGCCCCAGG - Intronic
1123022150 14:105404610-105404632 AGAACCTTCAAAGCAGCCACGGG + Intronic
1123071980 14:105646466-105646488 AATCAGAGCAGAGCAGCCACAGG - Intergenic
1123858327 15:24436299-24436321 AGCCCCAGCGGAGCTGCCACAGG + Intergenic
1123862955 15:24486763-24486785 AGCCCCAGCGGAGCTGCCACAGG + Intergenic
1124407612 15:29405669-29405691 AGGACCTGCTGAGCAGCCAAAGG - Intronic
1125719498 15:41838568-41838590 AGTCCCAGAACAGCAGCCAAGGG - Intronic
1127006926 15:54581319-54581341 AGTCCCAGAACAGCAGCCTCAGG + Intronic
1127771033 15:62230896-62230918 AGACCCTGCTGAGCACCCAGGGG + Intergenic
1127809202 15:62548760-62548782 AATCACTACATAGCAGCCACAGG - Intronic
1127830928 15:62750575-62750597 TAGCCCTGCAGACCAGCCACAGG - Intronic
1128328215 15:66738873-66738895 AGTCACTGCAGTGCATTCACAGG + Intronic
1128494894 15:68191894-68191916 AGTCCGTGAAGAGGAGCCCCAGG + Exonic
1129105631 15:73305439-73305461 AGTCCCTGCAGGGCAGCAACAGG - Intergenic
1130091290 15:80823469-80823491 AGTCCCTGCAGAGCCACATCAGG - Intronic
1130460724 15:84156898-84156920 AGACCCTGGGGAGCAGCCAGTGG - Intergenic
1130779182 15:87016899-87016921 AGTCCCTGCAGAGCAGCCACTGG + Intronic
1130952692 15:88605050-88605072 CGGCCCTCCAGAGCAGCCTCAGG - Intergenic
1131401603 15:92129667-92129689 AGTCCCTTGAAAGCTGCCACTGG - Intronic
1131572771 15:93555873-93555895 AGTCCCAGCAAAGGAGACACAGG + Intergenic
1132553218 16:561621-561643 GGGCCCTGCAGGGCAGTCACGGG - Intronic
1132600218 16:769767-769789 GGTCCCAGGAGAGCAGCCGCAGG - Intronic
1132701758 16:1225060-1225082 AGTCTCTTCAGAGGAGACACGGG + Intronic
1134207557 16:12250360-12250382 AGCCCCAGGAGAGAAGCCACAGG + Intronic
1135550680 16:23396010-23396032 CGTCCTAACAGAGCAGCCACTGG + Intronic
1135553308 16:23414973-23414995 AGTCCATGCAGTGGAGACACAGG + Intronic
1135858136 16:26031070-26031092 AGTATCTACAGAGCAGACACTGG + Intronic
1137411264 16:48230302-48230324 AATCCCTTCAGAGCAGCCTGAGG - Intronic
1138342689 16:56301019-56301041 ATTCCCTGCTGAGCAGCCACGGG + Intronic
1138656197 16:58492913-58492935 CCTCCCTGCAGAGCCACCACAGG + Intronic
1138715889 16:59021629-59021651 AGTCCATGTACAGCAGCCTCTGG + Intergenic
1139544900 16:67645487-67645509 AGTCCTTGCACAGAAGCCACTGG - Intronic
1139560696 16:67739950-67739972 AGTCCTTGGAGAGCCTCCACTGG - Intronic
1141045407 16:80712290-80712312 AGTCCCTGAAACGTAGCCACTGG + Intronic
1141078313 16:81029022-81029044 AATCCCTGGAAACCAGCCACTGG - Intronic
1141762553 16:86038442-86038464 GCTCCCTGCAGAGCGGCCCCCGG + Intergenic
1142307970 16:89295943-89295965 ACTCCCTGCAGAGCACCCCCAGG - Intronic
1142498455 17:319470-319492 CCTCCCCGCAGAGCAGACACTGG + Exonic
1143168253 17:4910028-4910050 AGGCCCAGCAGAGCTGCTACAGG + Intergenic
1143382032 17:6502583-6502605 AGAGCTTGCAGAGCAGCCACAGG + Intronic
1143593714 17:7901457-7901479 TGTCACACCAGAGCAGCCACAGG - Intronic
1143904811 17:10199515-10199537 GGTCCCTGGAGAGCAGGGACTGG - Intergenic
1144212878 17:13030124-13030146 AATGCCTGGAGAGCAGCCAGTGG + Intergenic
1144571881 17:16405468-16405490 AGTCCCTTCAAAGGAGCCAGGGG + Intergenic
1144577354 17:16437415-16437437 ATTCTCTGCAGGGCAGCCAGAGG + Intergenic
1144634996 17:16900427-16900449 AGAACCTGCAGATCAGGCACTGG - Intergenic
1146529962 17:33600092-33600114 TGTCTCTGCACAGCAGCCACAGG + Intronic
1146567300 17:33924343-33924365 AGCCCCTGGAGAGCAGACTCTGG - Intronic
1147909773 17:43848612-43848634 TGTCCCTGCAGTGCACCTACAGG + Exonic
1150354445 17:64471075-64471097 AGTCCCTAGAAAGCAGCCTCAGG - Intergenic
1151166468 17:72208065-72208087 AGACCCTGGAAAGAAGCCACTGG + Intergenic
1152377497 17:79926435-79926457 AGCCCCTCCAGAGCAGCCCCAGG + Intergenic
1152405951 17:80098074-80098096 AGGCCCTGCGGAGCAGACATTGG + Intronic
1152690592 17:81716111-81716133 GGTCACGGCAGAGCAGCCAGGGG - Intronic
1152863845 17:82710694-82710716 GGTCCCTGCAGAGGCTCCACCGG + Intergenic
1152892596 17:82891005-82891027 AGCCCCTCCAGAGCCCCCACTGG + Intronic
1154251159 18:12746397-12746419 GGTCCCTGCAGGGTGGCCACTGG + Intergenic
1155236652 18:23826707-23826729 AGTCCCTGGGGAGCAGCACCAGG - Exonic
1156684693 18:39630695-39630717 AGTCCCTACAGATCAGGGACAGG - Intergenic
1157329512 18:46693065-46693087 ATGCCCTGCAGGGCAGCCCCAGG - Intronic
1157483893 18:48073550-48073572 TGGCCCAGAAGAGCAGCCACTGG - Intronic
1157947078 18:51992468-51992490 AGTCCTTCCAGAGGAGCTACTGG - Intergenic
1159461393 18:68725765-68725787 AATCCCTTCAGAGCAGTAACTGG + Intronic
1160475576 18:79182826-79182848 AGGCTCTGCAGGGCAGTCACAGG - Intronic
1166369995 19:42295162-42295184 GGTCCCTCCACAGCTGCCACAGG + Exonic
1166899050 19:46044248-46044270 AGTCTTGGCAGAGCGGCCACAGG + Intronic
1167639079 19:50670460-50670482 AGTCCCTTCACAGCAGCCAGAGG + Intronic
1168162832 19:54523364-54523386 AGTCCCTGCAGTGCAGTGAACGG - Intergenic
925041237 2:733109-733131 AGTCCCTGGAGAGCAGCTCCTGG - Intergenic
926374064 2:12209397-12209419 AGTCCCTGGAGGGCAGCACCCGG + Intergenic
927095566 2:19745512-19745534 GGTGCCTGCAGAACACCCACAGG + Intergenic
928549122 2:32354645-32354667 AGTCCCTTCAGAGCCCCCAGTGG - Intergenic
928744789 2:34399188-34399210 ATTCCCTGCTGAGCTGCCTCTGG - Intergenic
929526520 2:42708414-42708436 TGTCCCTCCAAAACAGCCACGGG - Intronic
929782014 2:44963017-44963039 TGTCCAATCAGAGCAGCCACAGG + Intergenic
929862453 2:45691296-45691318 AGACACTGCAGACCAGCAACAGG - Intronic
930043645 2:47149328-47149350 AGTCCCTGAAAATCAGCCAAAGG - Intronic
933897476 2:86824698-86824720 AGTCCCTCCAGAGCACACTCAGG + Intronic
934763830 2:96869689-96869711 AGACCCTGCGAAGCAGCCGCGGG + Intronic
934854011 2:97717949-97717971 GATCACAGCAGAGCAGCCACGGG - Intronic
935705095 2:105849714-105849736 AATCACAGAAGAGCAGCCACTGG + Intronic
935891866 2:107687875-107687897 AGTGCCTCCACAGCAGTCACAGG + Intergenic
935925248 2:108061231-108061253 TATTCCTGCAGAGAAGCCACTGG - Intergenic
936976923 2:118229840-118229862 AGTCCAGGCAGAGAAGCCACTGG - Intergenic
937100001 2:119261312-119261334 AGTCCATGCAGACCACCCAGAGG + Intronic
937218482 2:120327627-120327649 AGTCCCTGCAGCACAGCGCCGGG - Intergenic
937225437 2:120366238-120366260 ATTCCCTACACAGCAGCCAGGGG - Intergenic
937467381 2:122146262-122146284 AGTCATTGCAGAGCAGGTACAGG + Intergenic
938537388 2:132257287-132257309 CTCCCCTGCAGAGCAGCGACCGG - Intronic
942227276 2:173828445-173828467 AGTCCCTGCACAGGAGCCTAGGG + Intergenic
943103835 2:183518706-183518728 AAACCCAGCAGAGCAGCCAGAGG + Intergenic
946141852 2:217698269-217698291 AGTTCCTGCAGCCCAGCCACAGG + Intronic
946848371 2:223881321-223881343 TATCCCTGCATAGCAGCCAGTGG + Intronic
947545636 2:231008448-231008470 GGACCCAGCAGGGCAGCCACTGG + Intronic
948107686 2:235428255-235428277 AGTTCCTGCAGAGTCGCCTCAGG - Intergenic
948710540 2:239822352-239822374 AGTCACTGTAGAGCATCCAGAGG + Intergenic
948874518 2:240819730-240819752 CTTCCCTGGAGAGGAGCCACCGG - Intronic
949030543 2:241795010-241795032 ATTCCCAGTAGTGCAGCCACAGG + Intronic
949032377 2:241803138-241803160 AGGCCCTGCAGCCCAGTCACTGG - Intronic
1170156317 20:13272700-13272722 AGTCCCTGGAGAGGGGCCATTGG - Intronic
1170758914 20:19231788-19231810 ACTCTCTGCAGAGCAGGAACAGG + Intronic
1171343925 20:24451788-24451810 AGTGCCTGCAGAGCAGTGCCTGG - Intergenic
1171866292 20:30489068-30489090 CTCCCCTGCAGAGCAGCGACCGG - Intergenic
1172890427 20:38260414-38260436 ATTCCCTGCAGAACAGCCCCGGG - Intronic
1173799640 20:45886970-45886992 AGTCCCCCCAGGGCAGCCCCTGG + Exonic
1175216241 20:57392892-57392914 TGTGCCTGCAGAGCCGGCACAGG + Intronic
1175367158 20:58463699-58463721 AGTCCAGGCAGGACAGCCACAGG + Intronic
1177120176 21:17128331-17128353 AGCTCCTGCAAAGCAGACACAGG + Intergenic
1179958568 21:44755324-44755346 ACTTCCTTCAGAGGAGCCACAGG + Intergenic
1180312999 22:11253927-11253949 CTCCCCTGCAGAGCAGCGACCGG - Intergenic
1182582132 22:31320476-31320498 AGTCCCTTCATACCTGCCACAGG - Intergenic
1182773986 22:32817571-32817593 GGTCCCTACAAAGCACCCACTGG - Intronic
1184518718 22:44979484-44979506 AGCCCCTGGAGGGCAGCCAGTGG + Intronic
1185014103 22:48333482-48333504 CGCCCTTGCAGAGCAGCCCCAGG - Intergenic
950142111 3:10622572-10622594 AGTCCAAGCAGAGCAGGCAGTGG + Intronic
950156262 3:10723722-10723744 AGCCCCTGCAGTACAGCCAGAGG - Intergenic
950529430 3:13544631-13544653 AGGCTCTGCAGAGGAGCCTCAGG + Intergenic
952325179 3:32314345-32314367 AATTTCTGCAGAGCAGCCACTGG - Intronic
954412775 3:50378232-50378254 CGTCCCTGCAGGGAAGCCAGGGG + Intronic
954807660 3:53229787-53229809 ACGCCCTGCAGAGCAGTCTCTGG + Intronic
956613433 3:71147211-71147233 CTTCCCTGCATAGCAGCCAGAGG + Intronic
959742306 3:109734954-109734976 AGTCCCTGGAGGGCAACTACCGG + Intergenic
960132963 3:114076910-114076932 AGTCACTGCAGAGCTGCCGGAGG + Exonic
960439911 3:117674284-117674306 GGTCACTGCATAGAAGCCACTGG + Intergenic
961435675 3:126915010-126915032 AGCCCCTGCTCAGCAGACACTGG - Intronic
961995853 3:131242024-131242046 AATGCCTGCCTAGCAGCCACAGG - Intronic
963176050 3:142298958-142298980 AGTCCCTGCTGAGCTGCGAGTGG - Intergenic
963246066 3:143064418-143064440 TGTCCTTGCATAGCACCCACTGG + Intergenic
965604627 3:170485940-170485962 ATTCCCTGCACACCAGCCCCTGG + Intronic
966050290 3:175608481-175608503 AGAGCCTGCAGTGCAGACACAGG + Intronic
966135784 3:176696689-176696711 AGACTCTTCACAGCAGCCACTGG + Intergenic
966334154 3:178849842-178849864 GATCCCTGAAAAGCAGCCACTGG + Intergenic
968761243 4:2443610-2443632 AGGCCCTGCAGAGTCCCCACAGG - Intronic
968947770 4:3674673-3674695 TGTCCCTGGAGAGCTGCCTCAGG + Intergenic
969424114 4:7113936-7113958 AGACCCAGCAGAACAGCCAGGGG - Intergenic
969724594 4:8911711-8911733 ACTCCCTGCAGGGCCTCCACAGG - Intergenic
970996985 4:22279096-22279118 AGTCTCCTCAGAGCAGCCAGTGG - Intergenic
971238568 4:24866445-24866467 AGTTCCTGCAAAGCAGACAAAGG - Intronic
975831696 4:78375751-78375773 GGTGCTTGCAGTGCAGCCACAGG + Exonic
978615345 4:110588071-110588093 GGACCTTGCGGAGCAGCCACAGG + Intergenic
979179457 4:117707375-117707397 AGTCTCAGCAGAGCAGCCACTGG + Intergenic
979384864 4:120053005-120053027 ATTCCCTCCAGAGCTGCCAATGG - Intergenic
983911491 4:173244425-173244447 ACTTCCTACACAGCAGCCACAGG - Intronic
984097117 4:175447539-175447561 AGTCCCTGAAGAGCAGCTTAAGG + Intergenic
985669574 5:1200586-1200608 AGGCCGTGCAGGGAAGCCACAGG - Intergenic
986210325 5:5665560-5665582 AGGCCCTGCAGAGCTTCAACTGG - Intergenic
989467123 5:41769663-41769685 AGGCCATGCTGAGCAGCCACTGG + Intronic
989571577 5:42951051-42951073 AACCCCAGCAGCGCAGCCACCGG + Intergenic
990990570 5:61679359-61679381 TGTCCCTGCAGGACAGACACTGG - Intronic
991596928 5:68315798-68315820 ACTCCCTTCAAAGCAGGCACAGG + Intergenic
992194329 5:74324791-74324813 ACTCCCTGCTGATCAGTCACTGG - Intergenic
992215261 5:74519186-74519208 ACTCCCTGCAGAGCTGCCCCTGG + Intergenic
992945342 5:81803848-81803870 ATCCCCTGCAGAGAAGCCCCTGG + Intergenic
993147551 5:84114444-84114466 AATTCCTGCAGAGCACCCCCTGG + Intronic
993864410 5:93175149-93175171 AGTCCCAGGAGTGAAGCCACAGG - Intergenic
996379744 5:122850877-122850899 AGTCCCAGCACAGAAGCCAGAGG + Intronic
996545210 5:124670803-124670825 AGTGACAGCAGAGCAACCACTGG + Intronic
998393651 5:141804247-141804269 AGGCACTGCAGTGCAGCCAAAGG - Intergenic
998562409 5:143183783-143183805 AGACACTGCTGAGGAGCCACAGG - Intronic
999768047 5:154755626-154755648 AGTCCCTGCAGAGAAGGGTCGGG - Intronic
1003255636 6:4472464-4472486 AATCCCTGCAGTTGAGCCACTGG - Intergenic
1003963575 6:11232216-11232238 AGCCGCTTCACAGCAGCCACTGG - Intronic
1004425249 6:15502664-15502686 AGGCCCTGCAGACCCGCCTCAGG + Intronic
1006091474 6:31631481-31631503 AATCCCTCCAGAGGAGCCAGGGG + Exonic
1006445951 6:34079901-34079923 ATTCCCTGCACAACAGCCAGAGG + Intronic
1007915909 6:45561502-45561524 AGTTCCTGCAGTGCAGCACCTGG + Intronic
1012122782 6:95387980-95388002 AGTCCCTGCTGAGCTGGCAAAGG - Intergenic
1016656498 6:146524276-146524298 AGTCCCTTAAGAGCAGAAACTGG + Intergenic
1017418678 6:154249621-154249643 AGTCCCTGGAGGGCAGCGATGGG + Intronic
1017989115 6:159470927-159470949 AGTCCTTGGAGAGCATCCACAGG - Intergenic
1018093076 6:160362594-160362616 ACTCTCTGGGGAGCAGCCACAGG + Intronic
1018876102 6:167824739-167824761 AGTCCTTGCTGTGCAGGCACCGG + Intergenic
1019016467 6:168883962-168883984 ATTTCCTGCAGAGCAGCTTCGGG - Intergenic
1019144738 6:169969519-169969541 TGCCCCTGCAGAGTAGCCAAGGG + Intergenic
1019268753 7:134169-134191 AGACCCTGCCAAGCAGCCCCTGG + Intergenic
1019949403 7:4359212-4359234 AGTCCCTGCAGAGCAATCTCTGG - Intergenic
1022465682 7:30652167-30652189 TGTCCCTGCAGCGGAGCCGCAGG - Intronic
1023972511 7:45001510-45001532 GGTCCCTACTAAGCAGCCACCGG - Intronic
1026287262 7:68974146-68974168 AGTTCCTGGAGCCCAGCCACAGG - Intergenic
1026526013 7:71154122-71154144 TGTCCCTGAAGAGCACCCTCAGG - Intronic
1029409265 7:100398354-100398376 AGTCCCTCCTGAGCAAACACAGG - Intronic
1030101324 7:105948080-105948102 AGTACATGCAGATCAGCCATTGG + Intronic
1033276040 7:139972159-139972181 AGTCCCTGCAGAGCAGAGGGAGG + Intronic
1034331842 7:150289470-150289492 AATCCCTCCTGAGCAGTCACTGG - Exonic
1034666194 7:152820400-152820422 AATCCCTCCTGAGCAGTCACTGG + Exonic
1034872414 7:154696054-154696076 AGTCCCTGGACTGAAGCCACAGG - Intronic
1035209627 7:157318182-157318204 TGTCCCTTCCCAGCAGCCACTGG - Intergenic
1035268847 7:157708072-157708094 CTTCCTTGCAGAGCAGCCAGCGG - Intronic
1035607413 8:939000-939022 AGACGCAGCAGAGCAGCCACCGG + Intergenic
1036579998 8:10065096-10065118 AGTCCCTGCAGAGGGCTCACTGG - Intronic
1036705540 8:11043544-11043566 AGCCCCTGGAGGGCAGGCACTGG + Intronic
1036761198 8:11509581-11509603 AGACCCGGCAGAGCACCCCCAGG - Intronic
1036779051 8:11633358-11633380 AGGCCCTGGAAAGCAGCCCCAGG + Intergenic
1036955876 8:13187820-13187842 AATCCCTGGGGAGCAGTCACAGG - Intronic
1037464943 8:19150735-19150757 AGCCACTGCAGTGCTGCCACTGG + Intergenic
1038443243 8:27586118-27586140 ACTCCCTGCAGTCCGGCCACAGG - Intergenic
1039432941 8:37539754-37539776 AGTCCCTGCAGGAGAGCCAAGGG + Intergenic
1039742201 8:40393181-40393203 AGCCCCTTCAAGGCAGCCACAGG - Intergenic
1041190972 8:55353897-55353919 AGTTCATACAGAGCAGCCAAAGG + Intronic
1044224187 8:89701088-89701110 ACTCCCTCCCCAGCAGCCACTGG + Intergenic
1047087151 8:121530554-121530576 AGTCCCTGTAGACCAGCAAAGGG - Intergenic
1047436414 8:124838934-124838956 CTTCCCTCAAGAGCAGCCACTGG - Intergenic
1047502987 8:125456450-125456472 AGTCCTTGGAGAGCAGGGACTGG + Intergenic
1047607812 8:126491991-126492013 AGACCCTGCAGATCAGCCAAAGG + Intergenic
1048203500 8:132396695-132396717 AATCCCTTCAGAGCAGTCCCTGG - Intronic
1048220210 8:132534167-132534189 ACTCCCAACAGAGCAGCCAGAGG + Intergenic
1048344380 8:133565874-133565896 AATCCCTGCAGGGAAACCACTGG - Intronic
1050053953 9:1632435-1632457 AGTCTCTACAGAGCAGCAAGAGG + Intergenic
1051596151 9:18826167-18826189 TGTCCCTGTAGAGCAGCCCCAGG + Intronic
1051697883 9:19788786-19788808 TGAGCCTGCAGAGCAGCAACGGG + Intergenic
1051879940 9:21829550-21829572 AGTCCCTGGAGAGAATACACGGG - Intronic
1057187596 9:93065613-93065635 AGACACAGCAGGGCAGCCACGGG - Intronic
1057439190 9:95070185-95070207 GGCCTCTGCAGAGTAGCCACAGG - Intronic
1058625453 9:106928892-106928914 AGTACTTGCAGAGCTGGCACCGG - Exonic
1059175553 9:112166965-112166987 AGTCACTGCAGAGCTGGGACGGG - Intronic
1059447523 9:114347989-114348011 TGTCCCTTCACAGCAGGCACAGG + Intronic
1060154457 9:121309483-121309505 AGTCCCTTCAGAGCAGCTATGGG - Intronic
1061281018 9:129597643-129597665 AGTCCCTGCAGGGCAGCGACCGG + Intergenic
1061325817 9:129863564-129863586 TGACCCTACCGAGCAGCCACTGG + Intronic
1061888487 9:133605449-133605471 AGTCCCTGCCCAGCCTCCACCGG + Intergenic
1062103675 9:134741157-134741179 AGGCCCTGCAGTGCAGCCTGCGG + Intronic
1062188500 9:135231412-135231434 CGTCCCGGCACAGCAGACACTGG + Intergenic
1185618731 X:1439314-1439336 AGCCCCTGCAGGGCGACCACCGG - Intronic
1186374184 X:8980854-8980876 AGTCAGTGCAGAGGTGCCACTGG + Intergenic
1189698151 X:43687078-43687100 AATGCCTGCAGGGCTGCCACAGG + Intronic
1190123946 X:47686911-47686933 AGTCCCTGTAGTTCAGCCATGGG + Intergenic
1195019857 X:100816352-100816374 ACTCTCTGTAGAGTAGCCACAGG + Intergenic
1195211258 X:102653588-102653610 ACCACCAGCAGAGCAGCCACTGG - Exonic
1195217410 X:102714545-102714567 ACCACCAGCAGAGCAGCCACTGG - Exonic
1196582521 X:117393869-117393891 AGCCCCTGCAGAGTCCCCACTGG - Intergenic
1197708651 X:129651215-129651237 GGGCCCTGGAGAGCAGCCCCAGG + Intronic
1198451281 X:136768781-136768803 CTTCCCTGCAGAGCAGCCCCTGG + Intronic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1202378526 Y:24258282-24258304 AGACCCTGGGGAGCAGCCAGTGG + Intergenic
1202492256 Y:25411839-25411861 AGACCCTGGGGAGCAGCCAGTGG - Intergenic