ID: 1130782038

View in Genome Browser
Species Human (GRCh38)
Location 15:87050448-87050470
Sequence CTGAGAACATGGAGCTACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130782038_1130782041 2 Left 1130782038 15:87050448-87050470 CCCAGGTAGCTCCATGTTCTCAG No data
Right 1130782041 15:87050473-87050495 TGAAAGATGCTGTATCAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130782038 Original CRISPR CTGAGAACATGGAGCTACCT GGG (reversed) Intergenic
No off target data available for this crispr