ID: 1130783367

View in Genome Browser
Species Human (GRCh38)
Location 15:87069130-87069152
Sequence CAGTTGTATCAGAGGCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130783364_1130783367 13 Left 1130783364 15:87069094-87069116 CCAGGATTGGGCAGAAGGAGCCA No data
Right 1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG No data
1130783365_1130783367 -7 Left 1130783365 15:87069114-87069136 CCACTGAATTGCAATACAGTTGT No data
Right 1130783367 15:87069130-87069152 CAGTTGTATCAGAGGCCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130783367 Original CRISPR CAGTTGTATCAGAGGCCTTG AGG Intergenic
No off target data available for this crispr