ID: 1130794715

View in Genome Browser
Species Human (GRCh38)
Location 15:87196001-87196023
Sequence AGCTGAGTTGGAATAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130794715_1130794720 27 Left 1130794715 15:87196001-87196023 CCAGAGATTATTCCAACTCAGCT No data
Right 1130794720 15:87196051-87196073 TCTATTTGACCAACACTGCTGGG No data
1130794715_1130794719 26 Left 1130794715 15:87196001-87196023 CCAGAGATTATTCCAACTCAGCT No data
Right 1130794719 15:87196050-87196072 TTCTATTTGACCAACACTGCTGG No data
1130794715_1130794717 -8 Left 1130794715 15:87196001-87196023 CCAGAGATTATTCCAACTCAGCT No data
Right 1130794717 15:87196016-87196038 ACTCAGCTATCTCTGAGCACTGG No data
1130794715_1130794718 0 Left 1130794715 15:87196001-87196023 CCAGAGATTATTCCAACTCAGCT No data
Right 1130794718 15:87196024-87196046 ATCTCTGAGCACTGGACTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130794715 Original CRISPR AGCTGAGTTGGAATAATCTC TGG (reversed) Intergenic
No off target data available for this crispr