ID: 1130794717

View in Genome Browser
Species Human (GRCh38)
Location 15:87196016-87196038
Sequence ACTCAGCTATCTCTGAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130794715_1130794717 -8 Left 1130794715 15:87196001-87196023 CCAGAGATTATTCCAACTCAGCT No data
Right 1130794717 15:87196016-87196038 ACTCAGCTATCTCTGAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130794717 Original CRISPR ACTCAGCTATCTCTGAGCAC TGG Intergenic
No off target data available for this crispr