ID: 1130796791

View in Genome Browser
Species Human (GRCh38)
Location 15:87218182-87218204
Sequence CACTTGGTCCAATGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130796791_1130796796 13 Left 1130796791 15:87218182-87218204 CCACTTCCCCATTGGACCAAGTG No data
Right 1130796796 15:87218218-87218240 CTACCCCAGCTCTTCACCTCAGG No data
1130796791_1130796797 14 Left 1130796791 15:87218182-87218204 CCACTTCCCCATTGGACCAAGTG No data
Right 1130796797 15:87218219-87218241 TACCCCAGCTCTTCACCTCAGGG No data
1130796791_1130796801 20 Left 1130796791 15:87218182-87218204 CCACTTCCCCATTGGACCAAGTG No data
Right 1130796801 15:87218225-87218247 AGCTCTTCACCTCAGGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130796791 Original CRISPR CACTTGGTCCAATGGGGAAG TGG (reversed) Intergenic
No off target data available for this crispr