ID: 1130796859

View in Genome Browser
Species Human (GRCh38)
Location 15:87218762-87218784
Sequence CAGGGTCCCCAGTTTGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130796854_1130796859 29 Left 1130796854 15:87218710-87218732 CCAAGGTTTGCATGATCCAACAC No data
Right 1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG No data
1130796855_1130796859 13 Left 1130796855 15:87218726-87218748 CCAACACAGATGATATATTTATC No data
Right 1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG No data
1130796858_1130796859 -9 Left 1130796858 15:87218748-87218770 CCTCACTATGAATTCAGGGTCCC No data
Right 1130796859 15:87218762-87218784 CAGGGTCCCCAGTTTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130796859 Original CRISPR CAGGGTCCCCAGTTTGAAAT TGG Intergenic
No off target data available for this crispr