ID: 1130810839

View in Genome Browser
Species Human (GRCh38)
Location 15:87377052-87377074
Sequence TTCAATATAAAAATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130810837_1130810839 7 Left 1130810837 15:87377022-87377044 CCATGTAATTTATAATGCAAAGA No data
Right 1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130810839 Original CRISPR TTCAATATAAAAATGGACAA AGG Intergenic
No off target data available for this crispr