ID: 1130813508

View in Genome Browser
Species Human (GRCh38)
Location 15:87406581-87406603
Sequence TAGAAATAGCTATACTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130813508_1130813510 10 Left 1130813508 15:87406581-87406603 CCATATTAGTATAGCTATTTCTA No data
Right 1130813510 15:87406614-87406636 ATTTACAAATTTATAATAGAAGG No data
1130813508_1130813513 30 Left 1130813508 15:87406581-87406603 CCATATTAGTATAGCTATTTCTA No data
Right 1130813513 15:87406634-87406656 AGGATGGAAGGAGAGAAAGAAGG No data
1130813508_1130813511 14 Left 1130813508 15:87406581-87406603 CCATATTAGTATAGCTATTTCTA No data
Right 1130813511 15:87406618-87406640 ACAAATTTATAATAGAAGGATGG No data
1130813508_1130813512 18 Left 1130813508 15:87406581-87406603 CCATATTAGTATAGCTATTTCTA No data
Right 1130813512 15:87406622-87406644 ATTTATAATAGAAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130813508 Original CRISPR TAGAAATAGCTATACTAATA TGG (reversed) Intergenic
No off target data available for this crispr