ID: 1130813512

View in Genome Browser
Species Human (GRCh38)
Location 15:87406622-87406644
Sequence ATTTATAATAGAAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130813508_1130813512 18 Left 1130813508 15:87406581-87406603 CCATATTAGTATAGCTATTTCTA No data
Right 1130813512 15:87406622-87406644 ATTTATAATAGAAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130813512 Original CRISPR ATTTATAATAGAAGGATGGA AGG Intergenic
No off target data available for this crispr