ID: 1130815378

View in Genome Browser
Species Human (GRCh38)
Location 15:87426579-87426601
Sequence GCTGATATGCAGATGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130815378_1130815381 8 Left 1130815378 15:87426579-87426601 CCTTCTGCCATCTGCATATCAGC No data
Right 1130815381 15:87426610-87426632 GACTGAACTATTGACTTGCCAGG No data
1130815378_1130815382 9 Left 1130815378 15:87426579-87426601 CCTTCTGCCATCTGCATATCAGC No data
Right 1130815382 15:87426611-87426633 ACTGAACTATTGACTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130815378 Original CRISPR GCTGATATGCAGATGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr