ID: 1130815871

View in Genome Browser
Species Human (GRCh38)
Location 15:87432103-87432125
Sequence CTGCATTTACAGATGAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130815870_1130815871 5 Left 1130815870 15:87432075-87432097 CCTCTTGTCAGGTAAGGATGATT 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130815871 Original CRISPR CTGCATTTACAGATGAAGTA AGG Intergenic
No off target data available for this crispr