ID: 1130815871 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:87432103-87432125 |
| Sequence | CTGCATTTACAGATGAAGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1130815870_1130815871 | 5 | Left | 1130815870 | 15:87432075-87432097 | CCTCTTGTCAGGTAAGGATGATT | 0: 1 1: 0 2: 1 3: 4 4: 103 |
||
| Right | 1130815871 | 15:87432103-87432125 | CTGCATTTACAGATGAAGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1130815871 | Original CRISPR | CTGCATTTACAGATGAAGTA AGG | Intergenic | ||
| No off target data available for this crispr | |||||