ID: 1130819547

View in Genome Browser
Species Human (GRCh38)
Location 15:87479919-87479941
Sequence GCTCAGCTACAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130819547_1130819553 24 Left 1130819547 15:87479919-87479941 CCCTGCTCCTTCTGTAGCTGAGC No data
Right 1130819553 15:87479966-87479988 CCATGACCACAGCTTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130819547 Original CRISPR GCTCAGCTACAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr