ID: 1130820262

View in Genome Browser
Species Human (GRCh38)
Location 15:87487725-87487747
Sequence TCTAGCCAACAGACTAAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130820261_1130820262 4 Left 1130820261 15:87487698-87487720 CCATTTTTAACATAGTTACACAT No data
Right 1130820262 15:87487725-87487747 TCTAGCCAACAGACTAAGTAAGG No data
1130820259_1130820262 22 Left 1130820259 15:87487680-87487702 CCTAATATTAGAACCAAACCATT No data
Right 1130820262 15:87487725-87487747 TCTAGCCAACAGACTAAGTAAGG No data
1130820260_1130820262 9 Left 1130820260 15:87487693-87487715 CCAAACCATTTTTAACATAGTTA No data
Right 1130820262 15:87487725-87487747 TCTAGCCAACAGACTAAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130820262 Original CRISPR TCTAGCCAACAGACTAAGTA AGG Intergenic
No off target data available for this crispr