ID: 1130825469

View in Genome Browser
Species Human (GRCh38)
Location 15:87540572-87540594
Sequence CTGGAGACTCAGAAGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130825463_1130825469 15 Left 1130825463 15:87540534-87540556 CCATGGGTACACGAAGGCATAGA No data
Right 1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130825469 Original CRISPR CTGGAGACTCAGAAGGTAGG AGG Intergenic
No off target data available for this crispr