ID: 1130828295

View in Genome Browser
Species Human (GRCh38)
Location 15:87572490-87572512
Sequence CAGCCTCTGCTACGGGACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130828291_1130828295 9 Left 1130828291 15:87572458-87572480 CCAGAGACATAAAATATTTGCTG No data
Right 1130828295 15:87572490-87572512 CAGCCTCTGCTACGGGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130828295 Original CRISPR CAGCCTCTGCTACGGGACAC TGG Intergenic
No off target data available for this crispr