ID: 1130829375

View in Genome Browser
Species Human (GRCh38)
Location 15:87583967-87583989
Sequence CTGTGAATACGGAAGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130829368_1130829375 0 Left 1130829368 15:87583944-87583966 CCGTCCAGTTATCCTGCTTACCC No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data
1130829367_1130829375 1 Left 1130829367 15:87583943-87583965 CCCGTCCAGTTATCCTGCTTACC No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data
1130829366_1130829375 2 Left 1130829366 15:87583942-87583964 CCCCGTCCAGTTATCCTGCTTAC No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data
1130829364_1130829375 17 Left 1130829364 15:87583927-87583949 CCAGATCTTCTGTGCCCCCGTCC No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data
1130829365_1130829375 3 Left 1130829365 15:87583941-87583963 CCCCCGTCCAGTTATCCTGCTTA No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data
1130829369_1130829375 -4 Left 1130829369 15:87583948-87583970 CCAGTTATCCTGCTTACCCCTGT No data
Right 1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130829375 Original CRISPR CTGTGAATACGGAAGAAGCA AGG Intergenic
No off target data available for this crispr