ID: 1130831820

View in Genome Browser
Species Human (GRCh38)
Location 15:87608702-87608724
Sequence CAGATTTTCCACTATAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130831820_1130831823 -10 Left 1130831820 15:87608702-87608724 CCCACTTTATAGTGGAAAATCTG No data
Right 1130831823 15:87608715-87608737 GGAAAATCTGAGGCTTTGAAAGG No data
1130831820_1130831824 24 Left 1130831820 15:87608702-87608724 CCCACTTTATAGTGGAAAATCTG No data
Right 1130831824 15:87608749-87608771 GTCTAAAATTACAGCGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130831820 Original CRISPR CAGATTTTCCACTATAAAGT GGG (reversed) Intergenic
No off target data available for this crispr