ID: 1130832432

View in Genome Browser
Species Human (GRCh38)
Location 15:87615382-87615404
Sequence GGAAATACCCTGCCTTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130832427_1130832432 1 Left 1130832427 15:87615358-87615380 CCACTGAGTGTGCACCAAAGCCA No data
Right 1130832432 15:87615382-87615404 GGAAATACCCTGCCTTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130832432 Original CRISPR GGAAATACCCTGCCTTCTCT GGG Intergenic
No off target data available for this crispr