ID: 1130832603

View in Genome Browser
Species Human (GRCh38)
Location 15:87616744-87616766
Sequence CTGTCTGGAGGGCTGATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130832592_1130832603 29 Left 1130832592 15:87616692-87616714 CCCATATAGAAGGCTGAAACTTT No data
Right 1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG No data
1130832591_1130832603 30 Left 1130832591 15:87616691-87616713 CCCCATATAGAAGGCTGAAACTT No data
Right 1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG No data
1130832593_1130832603 28 Left 1130832593 15:87616693-87616715 CCATATAGAAGGCTGAAACTTTG No data
Right 1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG No data
1130832596_1130832603 3 Left 1130832596 15:87616718-87616740 CCTTTCTGGTTCAAACGCATCCA No data
Right 1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG No data
1130832595_1130832603 4 Left 1130832595 15:87616717-87616739 CCCTTTCTGGTTCAAACGCATCC No data
Right 1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130832603 Original CRISPR CTGTCTGGAGGGCTGATGGG TGG Intergenic
No off target data available for this crispr