ID: 1130833238

View in Genome Browser
Species Human (GRCh38)
Location 15:87624357-87624379
Sequence CTGTCTAAGCAGGAGCTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130833236_1130833238 -7 Left 1130833236 15:87624341-87624363 CCAGCTGATGTTCTGTCTGTCTA No data
Right 1130833238 15:87624357-87624379 CTGTCTAAGCAGGAGCTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130833238 Original CRISPR CTGTCTAAGCAGGAGCTACA TGG Intergenic
No off target data available for this crispr