ID: 1130838884

View in Genome Browser
Species Human (GRCh38)
Location 15:87678756-87678778
Sequence CTAAGTCAACTGTACTATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130838884_1130838885 -5 Left 1130838884 15:87678756-87678778 CCAAAATAGTACAGTTGACTTAG No data
Right 1130838885 15:87678774-87678796 CTTAGTTTACTCAAGCACAGTGG No data
1130838884_1130838887 14 Left 1130838884 15:87678756-87678778 CCAAAATAGTACAGTTGACTTAG No data
Right 1130838887 15:87678793-87678815 GTGGCCCCCACCTTATTCACGGG No data
1130838884_1130838886 13 Left 1130838884 15:87678756-87678778 CCAAAATAGTACAGTTGACTTAG No data
Right 1130838886 15:87678792-87678814 AGTGGCCCCCACCTTATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130838884 Original CRISPR CTAAGTCAACTGTACTATTT TGG (reversed) Intergenic
No off target data available for this crispr