ID: 1130840034

View in Genome Browser
Species Human (GRCh38)
Location 15:87689959-87689981
Sequence ATGAATATAGAGCTGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130840034_1130840036 27 Left 1130840034 15:87689959-87689981 CCATTCTCCAGCTCTATATTCAT No data
Right 1130840036 15:87690009-87690031 CACAATGAAAACCACTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130840034 Original CRISPR ATGAATATAGAGCTGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr