ID: 1130840432

View in Genome Browser
Species Human (GRCh38)
Location 15:87694795-87694817
Sequence GTGGAGAGACGACCTCGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130840432_1130840436 15 Left 1130840432 15:87694795-87694817 CCAATCCGAGGTCGTCTCTCCAC No data
Right 1130840436 15:87694833-87694855 TCACAACAGTCTTCTCCCAGAGG No data
1130840432_1130840437 16 Left 1130840432 15:87694795-87694817 CCAATCCGAGGTCGTCTCTCCAC No data
Right 1130840437 15:87694834-87694856 CACAACAGTCTTCTCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130840432 Original CRISPR GTGGAGAGACGACCTCGGAT TGG (reversed) Intergenic
No off target data available for this crispr