ID: 1130842068

View in Genome Browser
Species Human (GRCh38)
Location 15:87710060-87710082
Sequence TGACCTTGCAGTCTTGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130842060_1130842068 29 Left 1130842060 15:87710008-87710030 CCAGAAATGATCCTAGGCCAAAG No data
Right 1130842068 15:87710060-87710082 TGACCTTGCAGTCTTGGGTAAGG No data
1130842063_1130842068 12 Left 1130842063 15:87710025-87710047 CCAAAGGAACAAATATAGACCAA No data
Right 1130842068 15:87710060-87710082 TGACCTTGCAGTCTTGGGTAAGG No data
1130842062_1130842068 18 Left 1130842062 15:87710019-87710041 CCTAGGCCAAAGGAACAAATATA No data
Right 1130842068 15:87710060-87710082 TGACCTTGCAGTCTTGGGTAAGG No data
1130842065_1130842068 -7 Left 1130842065 15:87710044-87710066 CCAAGGATCAAAAATTTGACCTT No data
Right 1130842068 15:87710060-87710082 TGACCTTGCAGTCTTGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130842068 Original CRISPR TGACCTTGCAGTCTTGGGTA AGG Intergenic
No off target data available for this crispr