ID: 1130843018

View in Genome Browser
Species Human (GRCh38)
Location 15:87719415-87719437
Sequence GAACTCTGGTTGGCCAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130843018_1130843022 -5 Left 1130843018 15:87719415-87719437 CCTGTACTGGCCAACCAGAGTTC No data
Right 1130843022 15:87719433-87719455 AGTTCTTTTAAGATGGACAAAGG No data
1130843018_1130843024 2 Left 1130843018 15:87719415-87719437 CCTGTACTGGCCAACCAGAGTTC No data
Right 1130843024 15:87719440-87719462 TTAAGATGGACAAAGGTGATGGG No data
1130843018_1130843023 1 Left 1130843018 15:87719415-87719437 CCTGTACTGGCCAACCAGAGTTC No data
Right 1130843023 15:87719439-87719461 TTTAAGATGGACAAAGGTGATGG No data
1130843018_1130843025 23 Left 1130843018 15:87719415-87719437 CCTGTACTGGCCAACCAGAGTTC No data
Right 1130843025 15:87719461-87719483 GGAAAGCACTTCTGCCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130843018 Original CRISPR GAACTCTGGTTGGCCAGTAC AGG (reversed) Intergenic
No off target data available for this crispr