ID: 1130843792

View in Genome Browser
Species Human (GRCh38)
Location 15:87725620-87725642
Sequence TTGGACCCCTTTAAGATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130843792_1130843799 20 Left 1130843792 15:87725620-87725642 CCTCAGATCTTAAAGGGGTCCAA No data
Right 1130843799 15:87725663-87725685 GCCCACCATGGACCCTCGGTTGG No data
1130843792_1130843794 8 Left 1130843792 15:87725620-87725642 CCTCAGATCTTAAAGGGGTCCAA No data
Right 1130843794 15:87725651-87725673 CTCCAGCCCTCTGCCCACCATGG No data
1130843792_1130843798 16 Left 1130843792 15:87725620-87725642 CCTCAGATCTTAAAGGGGTCCAA No data
Right 1130843798 15:87725659-87725681 CTCTGCCCACCATGGACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130843792 Original CRISPR TTGGACCCCTTTAAGATCTG AGG (reversed) Intergenic
No off target data available for this crispr