ID: 1130846601

View in Genome Browser
Species Human (GRCh38)
Location 15:87753589-87753611
Sequence GCTTGAAACGACTAGGGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130846601_1130846608 17 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846608 15:87753629-87753651 AGGTGTGAATCCAGGATAGCAGG No data
1130846601_1130846609 18 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846609 15:87753630-87753652 GGTGTGAATCCAGGATAGCAGGG No data
1130846601_1130846604 -3 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846601_1130846610 23 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846610 15:87753635-87753657 GAATCCAGGATAGCAGGGACAGG No data
1130846601_1130846611 24 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846611 15:87753636-87753658 AATCCAGGATAGCAGGGACAGGG No data
1130846601_1130846613 27 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846613 15:87753639-87753661 CCAGGATAGCAGGGACAGGGAGG No data
1130846601_1130846605 9 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130846601 Original CRISPR GCTTGAAACGACTAGGGCGT TGG (reversed) Intergenic
No off target data available for this crispr