ID: 1130846604

View in Genome Browser
Species Human (GRCh38)
Location 15:87753609-87753631
Sequence AGCTAGTGAGAGTGCCCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130846601_1130846604 -3 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846600_1130846604 11 Left 1130846600 15:87753575-87753597 CCAGGGTCGGGTCTCCAACGCCC No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846599_1130846604 18 Left 1130846599 15:87753568-87753590 CCATTTACCAGGGTCGGGTCTCC No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846603_1130846604 -10 Left 1130846603 15:87753596-87753618 CCTAGTCGTTTCAAGCTAGTGAG No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846602_1130846604 -9 Left 1130846602 15:87753595-87753617 CCCTAGTCGTTTCAAGCTAGTGA No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846593_1130846604 30 Left 1130846593 15:87753556-87753578 CCAGTTGGAATCCCATTTACCAG No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data
1130846598_1130846604 19 Left 1130846598 15:87753567-87753589 CCCATTTACCAGGGTCGGGTCTC No data
Right 1130846604 15:87753609-87753631 AGCTAGTGAGAGTGCCCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130846604 Original CRISPR AGCTAGTGAGAGTGCCCGTC AGG Intergenic
No off target data available for this crispr