ID: 1130846605

View in Genome Browser
Species Human (GRCh38)
Location 15:87753621-87753643
Sequence TGCCCGTCAGGTGTGAATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130846602_1130846605 3 Left 1130846602 15:87753595-87753617 CCCTAGTCGTTTCAAGCTAGTGA No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data
1130846600_1130846605 23 Left 1130846600 15:87753575-87753597 CCAGGGTCGGGTCTCCAACGCCC No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data
1130846599_1130846605 30 Left 1130846599 15:87753568-87753590 CCATTTACCAGGGTCGGGTCTCC No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data
1130846601_1130846605 9 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data
1130846603_1130846605 2 Left 1130846603 15:87753596-87753618 CCTAGTCGTTTCAAGCTAGTGAG No data
Right 1130846605 15:87753621-87753643 TGCCCGTCAGGTGTGAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130846605 Original CRISPR TGCCCGTCAGGTGTGAATCC AGG Intergenic
No off target data available for this crispr