ID: 1130846611

View in Genome Browser
Species Human (GRCh38)
Location 15:87753636-87753658
Sequence AATCCAGGATAGCAGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130846603_1130846611 17 Left 1130846603 15:87753596-87753618 CCTAGTCGTTTCAAGCTAGTGAG No data
Right 1130846611 15:87753636-87753658 AATCCAGGATAGCAGGGACAGGG No data
1130846601_1130846611 24 Left 1130846601 15:87753589-87753611 CCAACGCCCTAGTCGTTTCAAGC No data
Right 1130846611 15:87753636-87753658 AATCCAGGATAGCAGGGACAGGG No data
1130846606_1130846611 -10 Left 1130846606 15:87753623-87753645 CCCGTCAGGTGTGAATCCAGGAT No data
Right 1130846611 15:87753636-87753658 AATCCAGGATAGCAGGGACAGGG No data
1130846602_1130846611 18 Left 1130846602 15:87753595-87753617 CCCTAGTCGTTTCAAGCTAGTGA No data
Right 1130846611 15:87753636-87753658 AATCCAGGATAGCAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130846611 Original CRISPR AATCCAGGATAGCAGGGACA GGG Intergenic
No off target data available for this crispr