ID: 1130847130

View in Genome Browser
Species Human (GRCh38)
Location 15:87758078-87758100
Sequence CTGTCTTAAAAGATGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130847125_1130847130 2 Left 1130847125 15:87758053-87758075 CCAGCCTGGGCAACAGAGTGAGA 0: 21776
1: 73212
2: 167026
3: 221294
4: 302558
Right 1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG No data
1130847124_1130847130 12 Left 1130847124 15:87758043-87758065 CCGTTGTACTCCAGCCTGGGCAA 0: 2312
1: 45463
2: 120001
3: 189875
4: 216689
Right 1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG No data
1130847126_1130847130 -2 Left 1130847126 15:87758057-87758079 CCTGGGCAACAGAGTGAGACCCT 0: 4184
1: 22237
2: 70009
3: 146932
4: 263757
Right 1130847130 15:87758078-87758100 CTGTCTTAAAAGATGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130847130 Original CRISPR CTGTCTTAAAAGATGAAGGA AGG Intergenic
No off target data available for this crispr