ID: 1130850813

View in Genome Browser
Species Human (GRCh38)
Location 15:87791953-87791975
Sequence CAGGCATTCCTGAACTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130850813_1130850822 21 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850822 15:87791997-87792019 ACAACTACCTCATGGGCACAGGG No data
1130850813_1130850817 -2 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850817 15:87791974-87791996 TGCCTTTTGACATATTCACTTGG No data
1130850813_1130850824 28 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850824 15:87792004-87792026 CCTCATGGGCACAGGGTCTGAGG No data
1130850813_1130850820 14 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850820 15:87791990-87792012 CACTTGGACAACTACCTCATGGG No data
1130850813_1130850819 13 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850819 15:87791989-87792011 TCACTTGGACAACTACCTCATGG No data
1130850813_1130850821 20 Left 1130850813 15:87791953-87791975 CCCCAAAAGTTCAGGAATGCCTG No data
Right 1130850821 15:87791996-87792018 GACAACTACCTCATGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130850813 Original CRISPR CAGGCATTCCTGAACTTTTG GGG (reversed) Intergenic
No off target data available for this crispr