ID: 1130862863

View in Genome Browser
Species Human (GRCh38)
Location 15:87906729-87906751
Sequence GTGTGTGTGTAGTTTAGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 0, 2: 5, 3: 72, 4: 717}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130862863 Original CRISPR GTGTGTGTGTAGTTTAGGTA GGG (reversed) Intronic
902135163 1:14298871-14298893 GTGAGAGTGTAGTGTAGGTAGGG - Intergenic
902226999 1:15002671-15002693 GTGTGTGTGTTTTTTTGGTGAGG - Intronic
902866003 1:19279959-19279981 GTGTGAGTGTATTTTATGTGCGG + Intergenic
903149442 1:21395415-21395437 GTGTGTGTGATGTTTATATATGG + Intergenic
903194631 1:21676058-21676080 GTGTGTGTGTGTTTTGGGTGGGG + Intergenic
903343214 1:22667908-22667930 GTGTGTGTGTGTGTTGGGTAGGG - Intergenic
903969073 1:27107382-27107404 GTGTGTGTGTAGTGTGTGGAGGG - Intronic
904471409 1:30738847-30738869 GTGTGTCTGTGGTTTAGGCCAGG - Intronic
905720908 1:40200855-40200877 GTGTGTGTGTAGAGTAGCAATGG - Intronic
905720911 1:40200960-40200982 GTGTGTGTGTAGAGTAGCAATGG - Intronic
906427846 1:45728162-45728184 GTGTGTGTGTGTTTGAGGCAGGG + Intronic
906731041 1:48081364-48081386 GTGTGTGTGTGGTGGAGGTAGGG + Intergenic
907021905 1:51074618-51074640 GTGTGTGTGTAGTTTCGAGAGGG + Intergenic
907803094 1:57790911-57790933 GTGTGTGTGTATTTTAAACATGG + Intronic
907961683 1:59289688-59289710 GTGTGTGTGTAGTGTAAGTATGG + Intergenic
908496915 1:64703755-64703777 GTGTTTTTGTAGTATAGGTGTGG - Intergenic
908515354 1:64886739-64886761 GTGTGTGTGTAGACAAGGTTGGG - Intronic
908661618 1:66443333-66443355 GTGTGTGTGTAGTTTATTTCTGG + Intergenic
909201213 1:72692353-72692375 GTGTGTGTGTGTTTAAGGTTTGG + Intergenic
909613312 1:77576734-77576756 GTGTGAGTGTATTTTATGTGTGG - Intronic
909737669 1:78984678-78984700 GTGTGTGTGTTTTTTAAGAAAGG - Intronic
910730585 1:90391688-90391710 GTGTTAGTGTAGTTTATGTTTGG - Intergenic
911093647 1:94038017-94038039 ATGTGTGTGTGATTTAGGGAAGG - Intronic
911636457 1:100241400-100241422 GTGTGTGTGTATTTGAGACATGG + Intronic
912595507 1:110871802-110871824 GTGTGTGTGTAGTTTCTCTTGGG - Intergenic
913280929 1:117184380-117184402 GTGTGTGTGTTGGTCAGGGATGG - Intronic
913364481 1:118021404-118021426 GTGTGTGTGTGGTTCAGGATGGG + Intronic
913505560 1:119513560-119513582 GTGTGTGTGTACTTTAATTTTGG - Intronic
913516264 1:119608149-119608171 GTGTGTGTGTAGTTTAATTTTGG - Intergenic
914743562 1:150484973-150484995 GTGTGTGTGTGGTTTGGAGAAGG - Intergenic
914792001 1:150886461-150886483 GTGTGTGTGTATTTAAGAGATGG - Intergenic
914853210 1:151330375-151330397 GTGTGTGTGTATTTTTAGTAGGG - Intergenic
915265556 1:154714298-154714320 GTGTGTGTGTGGTTTGTGTGAGG + Intronic
915265579 1:154714474-154714496 GTGTGTGTGTGGTTTGTGTGAGG + Intronic
915292262 1:154893766-154893788 GTGTGTGTTTAGTAGAGGCAGGG - Intergenic
915826605 1:159084766-159084788 GTGTGTGTGTATTTCAGACAGGG - Intronic
915951777 1:160193976-160193998 GTGTGCGTGTGGTGTATGTATGG - Intronic
917160841 1:172055405-172055427 GTGTGTGTGTATTTGTGGGAAGG - Intronic
918090962 1:181294531-181294553 GTGTGTGTGTATTTAATGAAAGG - Intergenic
918446726 1:184624273-184624295 GTGTGTGTGCAGCTCAGATAGGG - Exonic
919578758 1:199344619-199344641 GTGTGTGTGTAGTAGAGATGGGG - Intergenic
919977944 1:202625074-202625096 GTGTGTGTGTGGTTTGTGTGTGG + Intronic
920132676 1:203744815-203744837 GTGTGTGTGTATTTTAGAGATGG - Intergenic
920440120 1:205975344-205975366 GTGTGTGTGTGGTATGTGTATGG - Intergenic
920968852 1:210725205-210725227 GTGTCTGTGTAGTGCAGCTACGG - Intronic
922236550 1:223726677-223726699 ATGTGTGTGCAGTTTAGGGAAGG + Intronic
923011771 1:230094006-230094028 GTGTGTGTGTGTTTGAGATAGGG + Intronic
923954764 1:239003786-239003808 GTGTGTGTGTTGTTGGGGTGGGG - Intergenic
924431287 1:243999020-243999042 GTGTGTGTGTAGTCTGGATGTGG - Intergenic
1063070541 10:2658784-2658806 GTGTGTGTGGAATTCAGGTACGG - Intergenic
1063274838 10:4554296-4554318 GTGTGTGTGTGGCTGAGGTCAGG - Intergenic
1063487734 10:6435663-6435685 GTGTTAGTGTATTTTAGGTGTGG - Intronic
1063617561 10:7614511-7614533 GTGTGAGTGTATTTTATGCATGG + Intronic
1064054143 10:12083241-12083263 GTGTTAGTGTATTTTATGTATGG - Intronic
1065346905 10:24757309-24757331 GTGTGTGTGTATTTGAGACATGG + Intergenic
1065871736 10:29961459-29961481 GTGTCTGGGGAGTTTAGGGAAGG + Intergenic
1066170994 10:32845756-32845778 GTGTGTGTGTAATTATGGAAGGG - Intronic
1066202492 10:33155368-33155390 ATATGTGTGTATTTTAGGAAGGG - Intergenic
1066360724 10:34727803-34727825 GTGTGTGTGTGGTGGAGGGAGGG - Intronic
1066363579 10:34754756-34754778 GTATGTGTATAGTTTAAGTCAGG - Intronic
1066585560 10:36930533-36930555 GTGTTTGTGTATTTTATGTGTGG - Intergenic
1066976558 10:42373712-42373734 GTGTGTGTGTCATGTATGTATGG - Intergenic
1068487200 10:57675209-57675231 GTTTGTCTGTATTTTAGGAATGG + Intergenic
1068499206 10:57821573-57821595 GTGTGAGTGTATTTTATGTGTGG - Intergenic
1068624685 10:59229791-59229813 GTGTGTGAGTGGTTGAAGTATGG + Intronic
1068819728 10:61360348-61360370 GTGTGTGTGTGGTGGAGGCAGGG - Intergenic
1068943103 10:62700855-62700877 GTGTGTGTGTTGTTTATGCCTGG + Intergenic
1069003458 10:63291955-63291977 GTGTGTGTGTATTTGAGACAGGG + Intronic
1070479760 10:76870613-76870635 GTGTGTGTGCTGTTCAGGGAGGG + Intronic
1070548478 10:77472071-77472093 GTGTGTGTGTGGTATGTGTATGG - Intronic
1071194176 10:83137794-83137816 GTGTGTGTGTATTTGAGGTAGGG - Intergenic
1071290712 10:84186955-84186977 GTGTGTGTGTGGTGTATGTGTGG + Intergenic
1071368877 10:84930429-84930451 GTGTGCTTGTAGTTTAGGAATGG - Intergenic
1071788987 10:88934600-88934622 GTGTGTGTGTATTAGAGATAAGG - Intronic
1071804067 10:89097335-89097357 GTGTGTGTGTTGTGTAGAGAAGG - Intergenic
1071968869 10:90882334-90882356 GTGTGTATGTAGTTTTTATAAGG - Intronic
1072658618 10:97348234-97348256 GTGTGTGTGCAGTTGGGGTTGGG - Intergenic
1072712286 10:97723729-97723751 GTGTGTGTGTAGTAGAGATGGGG - Intergenic
1072879779 10:99215119-99215141 GTGTTTTTATAGTTTAGGTTGGG - Intronic
1072988696 10:100168179-100168201 GTGTGTTTGCAGTATAGGTGGGG - Intronic
1075038039 10:119085671-119085693 GTGTGTGAGTGGCTGAGGTAAGG - Intergenic
1075351702 10:121730278-121730300 GTGTGTGTGTATTTTGAGAAAGG + Intergenic
1075604513 10:123794775-123794797 GTGTGTGTGTATTTGAGACAGGG + Intronic
1075997712 10:126892010-126892032 GTATGTGTGTGGTTTTGGTGTGG - Intergenic
1076210776 10:128642911-128642933 GTGTTAGTGTATTTTATGTATGG - Intergenic
1077939349 11:6824046-6824068 GTGTGTGTGTATTTGAGACAGGG - Intergenic
1078313075 11:10265887-10265909 GTGTGTGTGTGTTTTAGAGATGG + Intronic
1078350129 11:10586160-10586182 GTGTGTGTGGAGGGTGGGTAGGG + Intronic
1078655554 11:13235462-13235484 GTGTGTGTGTGTTTAAGATAGGG - Intergenic
1078933795 11:15934981-15935003 GTGTGTGTGTGGTGTAGAGAGGG - Intergenic
1079016119 11:16870301-16870323 GTGTGTGTGTAGTGTGTGTGTGG - Intronic
1079124757 11:17710416-17710438 GTGTGTGTGTTCTGTAGGTGAGG + Intergenic
1079552798 11:21721288-21721310 GTGTGTGTATGTTTTTGGTAAGG + Intergenic
1079784417 11:24653551-24653573 GTGTGTCTTTAGCTTAGCTATGG + Intronic
1080910373 11:36591586-36591608 GTGTGTGTGTAGTTAACATGTGG - Intronic
1081412106 11:42772019-42772041 GTGTGTGTGTATTACATGTATGG + Intergenic
1081602406 11:44504336-44504358 GTGTGTGTGTAGTGTATGGAGGG - Intergenic
1081829705 11:46097816-46097838 GTGTGTGTGTGTTCTAGTTAGGG - Intronic
1082822274 11:57552202-57552224 GTGTGTGTGTGGTGGAGGGAAGG - Exonic
1082974148 11:59055588-59055610 GTGTGTGTGTATGTTGGGTGGGG - Intergenic
1083052244 11:59787698-59787720 GTGTTAGTGTATTTTATGTATGG - Intronic
1083928470 11:65824213-65824235 GTGTGTGTGTGTTTGAGATAGGG + Intronic
1084925436 11:72507731-72507753 GTGTTAGTGTATTTTATGTATGG + Intergenic
1085539904 11:77257540-77257562 GTGTGTGTGTAGGAGAGGGAGGG - Intronic
1085826322 11:79851538-79851560 GTGTGTGTTTAGTTTGGGGGTGG + Intergenic
1086597180 11:88586793-88586815 GTGTGTGGGTGGTCTGGGTAGGG - Intronic
1086737042 11:90319859-90319881 GTGTGTGTGTTGGGTAGGTGGGG - Intergenic
1087185337 11:95186232-95186254 GTGTGTGTGTGGTGTATGTAAGG + Intronic
1087186682 11:95206353-95206375 GTGTGTGTGTATTTTAGGACTGG - Intronic
1087257021 11:95967529-95967551 GTGTGTGTGTGTTTTGGGTCTGG + Intergenic
1088275811 11:108084020-108084042 GTGTTAGTGTATTTTATGTATGG + Intronic
1088682365 11:112254341-112254363 GTGTGTGTGTGGTATTTGTATGG + Intronic
1089039499 11:115433129-115433151 GTGTGTGTGATGTTTGGGTGGGG - Intronic
1089310106 11:117552332-117552354 GTGTCTGTGTAGATTGGGGATGG - Intronic
1089490178 11:118878267-118878289 GTTTGTGTCTGGTTTAGGCAAGG - Intergenic
1090219908 11:125010963-125010985 GTTTGTGTATAGTAAAGGTAGGG + Intronic
1090819519 11:130328643-130328665 GTGTGTGTGTATTCAAGATAGGG - Intergenic
1091017121 11:132061936-132061958 GTGTGTGTGTGGATCAGATAGGG + Intronic
1091020041 11:132091221-132091243 GTGTGTATGTATTTTTAGTAGGG - Intronic
1091332317 11:134739535-134739557 GTGTGTGTGTAGTGTGTGTAAGG + Intergenic
1091648730 12:2293598-2293620 GTGTTAGTGTATTTTATGTATGG + Intronic
1092025149 12:5233549-5233571 GTGTGTGTTTGCTTTAGATATGG + Intergenic
1092071810 12:5637363-5637385 GTGTGTGTGTATTTGGGGTTGGG + Intronic
1092225182 12:6743905-6743927 GTGTGTGTGTATTTTTAGTAGGG + Intergenic
1092501934 12:9056579-9056601 GTGTGTGTGTATTTTAGGGATGG + Intergenic
1093138364 12:15478537-15478559 ATGTGTGTTTAATTTGGGTATGG + Intronic
1094444356 12:30513664-30513686 GTGTGTGTGTATCTTAGAAATGG + Intergenic
1095165097 12:38962888-38962910 GTGTGTGTGTTGTATGGGAAGGG + Intergenic
1096357896 12:50957976-50957998 GTGTGTGTGTAGTAGAGGCAGGG + Intronic
1096542568 12:52316249-52316271 GTGTGTGTGTAGTGTAAGTGAGG - Intronic
1096834398 12:54340044-54340066 GTGTGTGGGTGGTTTAGGGAAGG + Intronic
1097184957 12:57191609-57191631 GTGTGTGTGTGGTATGTGTAGGG - Intronic
1097859209 12:64501313-64501335 TTGTGTGTGTGTTTTAGGTTTGG + Exonic
1097993548 12:65862719-65862741 GTGTGTGTGAAGTTTAGGAGAGG + Intronic
1098929670 12:76396743-76396765 GTATGTGTGTTTTTTAGGCAAGG - Intronic
1099943297 12:89216147-89216169 TTGTGTATGTGGTTTATGTATGG - Intergenic
1100201925 12:92307918-92307940 GTGTGTGTGTATTTCAGACAGGG + Intergenic
1100494802 12:95114431-95114453 GTGTGTGTGTAGTAGAGATGGGG - Intronic
1100578821 12:95919343-95919365 GTGTATGAGTGGTTGAGGTACGG + Intronic
1101276414 12:103206509-103206531 GTGTGTGTGTAATATAGAAAAGG - Intergenic
1101654093 12:106704845-106704867 GTGTGTGTGTCGTATGGGCAGGG + Intronic
1101714871 12:107302013-107302035 GTGTTAGTGTATTTTATGTATGG + Intergenic
1101736163 12:107464941-107464963 GTGTGTGTGTGTGTAAGGTAGGG - Intronic
1102108283 12:110344536-110344558 GTGTGTGTGTACTCCATGTAAGG - Intronic
1102143777 12:110638546-110638568 GTGTGTGTGTGGTTTGGGAATGG + Intronic
1102655976 12:114482545-114482567 GTGTCTGTGTATTTTGGATACGG + Intergenic
1103797113 12:123510919-123510941 GTGTGTGTGTGGTGTGTGTAAGG + Intronic
1103815769 12:123654487-123654509 GGGTGTGTGTATTTGGGGTATGG + Intronic
1104331436 12:127850282-127850304 TTTTGTGTGTGGTTTAGGGAAGG + Intergenic
1104586916 12:130055033-130055055 TTGTGTGTGTGGTTGTGGTATGG - Intergenic
1104586928 12:130055125-130055147 GTGTGTGTGTGGTTGTGGTTGGG - Intergenic
1104596490 12:130123719-130123741 GTGTTTGTGTATTTTATGTGTGG - Intergenic
1105282824 13:18978820-18978842 GTGTATGTGTAGTGTAGTGAGGG - Intergenic
1105450807 13:20497828-20497850 GTGTGTATGTGGTGTATGTATGG - Intronic
1105450816 13:20498058-20498080 GTGTGTGTGTAGTGTGTATAGGG - Intronic
1105450837 13:20498264-20498286 GTGTGTGTGTAGTGTGTATATGG - Intronic
1105450845 13:20498422-20498444 GTGTGTGTGTAGTGTGTATATGG - Intronic
1105781328 13:23707166-23707188 GTGTGTGTGTGTTTGAGGCAGGG + Intergenic
1105890997 13:24681882-24681904 GTGTGTGTGTGGTGTATGTGTGG + Intronic
1106154370 13:27139156-27139178 GTGTGTCTGCATGTTAGGTATGG - Intronic
1106240410 13:27907720-27907742 GTGTGTGTGTTGTATGTGTATGG + Intergenic
1107011905 13:35678473-35678495 GTGTTTGTGTATTTTGGGTGTGG + Intergenic
1107146668 13:37067734-37067756 GTTTGTGTTTTCTTTAGGTAAGG + Intergenic
1107152404 13:37127460-37127482 GTGTGTGTGTATTACAGGAAGGG - Intergenic
1107288991 13:38830654-38830676 GTGTGGCTGTAGTATAGGAAAGG - Intronic
1107829750 13:44363991-44364013 GTGTGTGTGTATGTAAGGAAGGG - Intergenic
1108082735 13:46754030-46754052 GTCTGTGTGTATTTTATGTGGGG - Intergenic
1108274047 13:48790036-48790058 GTGTTAGTGTATTTTATGTATGG - Intergenic
1108769598 13:53682781-53682803 GTGTGTGTGTAATTTAATAAGGG + Intergenic
1108878471 13:55077697-55077719 GTGTGTGTGTGTTTTAGAAATGG + Intergenic
1110808349 13:79784870-79784892 GTGTGTGTGTGTCTTAGGTTAGG - Intergenic
1111003995 13:82224917-82224939 GTGTGTGTGTGTTTTAGGCGGGG - Intergenic
1111004097 13:82226196-82226218 GTGTGTGTGTGTTTTATGTGGGG - Intergenic
1111211504 13:85085447-85085469 GTGTGTGTGTAGTATAATTTTGG + Intergenic
1111519697 13:89384575-89384597 GTGTGTGTGTAGTGGAGACAGGG - Intergenic
1112011776 13:95299611-95299633 GTGTTAGTGTATTTTATGTATGG + Intronic
1112773168 13:102814129-102814151 GTGTGTGTGTGCTGTGGGTAGGG + Intronic
1113406299 13:110043763-110043785 GTGTGTGTGTGGTATATGTGTGG - Intergenic
1113607602 13:111621722-111621744 GTGTGTGTGTGGTGTATGTATGG + Intronic
1113697712 13:112358656-112358678 GTGTATGTGTAGTGTATGTGTGG + Intergenic
1114393649 14:22337216-22337238 GTGTGTGTGTGTGTTTGGTAGGG - Intergenic
1115573864 14:34692330-34692352 GTGTGTGTGTGGTTTGGGAAAGG - Intergenic
1115635763 14:35288996-35289018 GTGTTAGTGTAGTTTATGTGTGG + Intronic
1116087693 14:40262336-40262358 GTGTGTGTGTAGTAAAAGTAAGG - Intergenic
1116493371 14:45532734-45532756 TTGTGTGTGTTGATTAGGTGGGG + Intergenic
1117078504 14:52127902-52127924 GTGTGTGAGTAGTTGAAGTATGG - Intergenic
1117326993 14:54678507-54678529 GTGTGTGTGTAGGTCAGGTGGGG + Intronic
1117475431 14:56089922-56089944 GTGTGTGTGTGTGTTATGTATGG - Intergenic
1118012988 14:61628943-61628965 ATGTGTGTGTGAATTAGGTAAGG - Intronic
1118313546 14:64709757-64709779 GTGTGTGTGTAGTATTAGAAAGG + Intronic
1118451606 14:65907453-65907475 GTGTGTGTGTGGCATAAGTAGGG + Intergenic
1118982173 14:70725817-70725839 GTGTGTGTGAAATATACGTACGG - Intronic
1119411136 14:74431243-74431265 GTGTGTGTATATGTAAGGTAGGG + Intergenic
1119480956 14:74957252-74957274 GTGTGTCTTTAGTTTGGGTATGG + Intergenic
1119574705 14:75708932-75708954 TTGTTAGTGTATTTTAGGTATGG - Intronic
1119879690 14:78090513-78090535 GTGTGTGTGTTGGTTAGGGTAGG + Intergenic
1120291596 14:82580207-82580229 GTGTCAGTGTATTTTATGTATGG - Intergenic
1121171783 14:91860617-91860639 GTGTGTGTGTATGTCAGGAAGGG - Intronic
1121563245 14:94889748-94889770 GTGTGTGTGTAGTGTGTGCATGG + Intergenic
1122277543 14:100602813-100602835 GTGTGTGTGTAGTGTAAGGTTGG + Intergenic
1122277547 14:100602838-100602860 GTGTGTGTGTAGTGTAAGTTTGG + Intergenic
1122277550 14:100602905-100602927 GTGTGTGTGTAGTGTAAGGTTGG + Intergenic
1122718832 14:103710975-103710997 GGGTGTGTGCAGTTTATATAAGG - Intronic
1123142164 14:106090833-106090855 GTGTATGAGTGGTTAAGGTATGG - Intergenic
1123186337 14:106520833-106520855 GTGTATGAGTGGTTGAGGTATGG - Intergenic
1202943196 14_KI270726v1_random:2589-2611 GTGTATGAGTGGTTAAGGTATGG + Intergenic
1123890227 15:24770706-24770728 GTGTGTGTGTGGTTGAGACAAGG + Intergenic
1124121531 15:26892936-26892958 GCGTGTGTGTAGTGTGTGTATGG + Intronic
1124168512 15:27351075-27351097 GTGTGTGTATAGTGTGTGTATGG + Intronic
1124968968 15:34465700-34465722 GTGTTTGTGTAGTGTTTGTATGG + Intergenic
1125101553 15:35919086-35919108 GTGTGTGTGTCGTAAAGATAAGG + Intergenic
1125762804 15:42109083-42109105 GTATGTGAGTGGTTGAGGTATGG + Intergenic
1126621025 15:50640155-50640177 GTGTGTGTGTGTTTTGCGTATGG - Intronic
1126908054 15:53388970-53388992 GTTTGTGTACAGTTTAGTTAAGG - Intergenic
1127696875 15:61458738-61458760 GTGTGTGTGTATTATATATAAGG - Intergenic
1128398254 15:67251248-67251270 GTGTGTGTGTATTTGAGACAGGG + Intronic
1130109818 15:80954875-80954897 GTGTTAGTGTATTTTACGTATGG + Intronic
1130372610 15:83298564-83298586 GTGTGTGTGTTTTATAGTTAGGG + Intergenic
1130862863 15:87906729-87906751 GTGTGTGTGTAGTTTAGGTAGGG - Intronic
1132764699 16:1528292-1528314 GTGTGTGTGTGGCTTTGGTGGGG - Intronic
1133635334 16:7659544-7659566 GTGTATGTGTACTTTATGTGTGG - Intronic
1134138888 16:11699507-11699529 GTTTGAGTGTAGTTTGAGTATGG - Intronic
1135067067 16:19319045-19319067 GTGTGTGTGTAAATTTGGTGGGG - Intronic
1135839031 16:25856607-25856629 GTGTTAGTGTATTTTATGTATGG - Intronic
1136692931 16:32049215-32049237 GTGTATGAGTGGTTGAGGTATGG + Intergenic
1136793426 16:32992440-32992462 GTGTATGAGTGGTTGAGGTATGG + Intergenic
1136876428 16:33861616-33861638 GTGTATGAGTGGTTGAGGTATGG - Intergenic
1137001939 16:35236705-35236727 ATTTGTGTATAGTATAGGTAAGG + Intergenic
1137273028 16:46915418-46915440 GTGTGTGTGTAGGTGTGGTGGGG - Intronic
1137273050 16:46915589-46915611 GTGTGTGTGTAGGTGTGGTGGGG - Intronic
1137273090 16:46915874-46915896 GTGTGTGTGTAGTTGTAGTGTGG - Intronic
1137655633 16:50155303-50155325 GTGTGTGTGTAGCTTGAGTATGG + Intronic
1137680594 16:50341165-50341187 GTGTGTGTGTACTTAAGGTCTGG - Intronic
1138140168 16:54561158-54561180 GTGTGTGTGTGGTGTAAGTGTGG - Intergenic
1138191842 16:55019665-55019687 GTGTGTGTGTGGTGTATGTGTGG - Intergenic
1139445814 16:66997938-66997960 GTGTGTGTGTGTTTTAGATAGGG - Intronic
1140288270 16:73625590-73625612 GTGTTTCTGTGGTTTAGATAAGG + Intergenic
1140586427 16:76298516-76298538 GTGTGTGTGTGTGTGAGGTAAGG + Intronic
1140758968 16:78094073-78094095 GTGTTTGTGTATTTGAGGTTGGG + Intergenic
1140997500 16:80275635-80275657 GTGTGTGTGTGCTGGAGGTATGG + Intergenic
1141806105 16:86342580-86342602 GTGTTAGTGTATTTTAGGTATGG - Intergenic
1142441748 16:90102893-90102915 GTGAGTGTTTAGCTTAGGTGTGG + Intergenic
1203095686 16_KI270728v1_random:1254131-1254153 GTGTATGAGTGGTTGAGGTATGG + Intergenic
1143428599 17:6862073-6862095 GTGTGTGTGTAGTAGAGACAGGG + Intergenic
1143658636 17:8311771-8311793 GTTTGTGTGTGGTTTGTGTAGGG - Intronic
1143686221 17:8518137-8518159 GTGTGTGTGTGTTTGAGATAGGG + Intronic
1143780928 17:9229375-9229397 GTGTGTGTGGAGATTAAATAAGG - Intronic
1144116327 17:12095919-12095941 GTGTGTGTGTATTTTAGTATTGG + Intronic
1145285054 17:21499468-21499490 GTGTTAGTGTATTTTATGTATGG + Intergenic
1146827041 17:36031984-36032006 GTGTGTGGGTTCTTTAGGAAAGG - Intergenic
1146957462 17:36943794-36943816 GTGTATGTGTAGTTTTGCGAAGG - Exonic
1147492284 17:40881253-40881275 GTGTGTGTGTATTTGAGACAGGG + Intronic
1147811956 17:43177562-43177584 GTGTGTGTGTGTTTTGGGTGGGG - Intronic
1148681585 17:49477087-49477109 GTGTGTGTGTGGTGGAGGAAAGG - Intergenic
1149009483 17:51840466-51840488 GTGTGTGTGTATTAAAGGTTGGG - Intronic
1149174055 17:53848105-53848127 GTCTGTGTGTGTTTTAGGAATGG - Intergenic
1149418099 17:56481479-56481501 GTGTGTGTGTGTTTTGGGGAGGG - Intronic
1150340239 17:64360836-64360858 GTGTGTGTGTATTTGAGACAGGG + Intronic
1150653762 17:67026309-67026331 GTGTGTGTGTATTTGAGGACTGG + Intronic
1150653769 17:67026380-67026402 GTGTGTGTGTATTTGAGGACTGG + Intronic
1151648961 17:75453872-75453894 GTGTTAGTGTAGTTTATGTGTGG + Intronic
1152056294 17:78030334-78030356 GTGTGTGTGTAGTAGAGACAGGG + Intronic
1153660645 18:7322799-7322821 GTGTGTGTTTTGTTTTGGTTTGG - Intergenic
1153835911 18:8963575-8963597 GTGTGTGTGTGGTGTGTGTATGG - Intergenic
1154045477 18:10900703-10900725 GTGTGTGTGTGGTTGATGTTTGG - Intronic
1154082344 18:11270188-11270210 GTGTGTGTGTATTTTAGGCTTGG + Intergenic
1154353793 18:13609545-13609567 GTGTGTGTGTGTGTTAGGTGTGG + Intronic
1155360683 18:24997765-24997787 GTGTGTGTGTGTTTTAGTTATGG + Intergenic
1155393616 18:25363300-25363322 GTGTGTGTGTAGTTTAGAAGCGG - Intergenic
1155435214 18:25805595-25805617 GTATGTGTTTACTTTACGTAAGG + Intergenic
1155889046 18:31243855-31243877 GTATGTGTCAAGTTTAAGTAAGG - Intergenic
1156053863 18:32973557-32973579 GTGTGTGTGTGCTTTATATATGG - Intronic
1156130009 18:33961306-33961328 GTGTGTGTGTAGGGTGGGTGAGG + Intronic
1156432310 18:37089168-37089190 GTATGTGTGTGTTTGAGGTAGGG + Intronic
1156485456 18:37462841-37462863 GTGTTAGTGTATTTTAGGTGTGG + Intronic
1156521205 18:37723689-37723711 GTGTGTGTGTGTTATAGGGAGGG + Intergenic
1156651429 18:39231136-39231158 GTGTGTGTGGAGAATAGGTAGGG - Intergenic
1156899944 18:42288764-42288786 GTGTGTGTGGTGTTTAGGATAGG - Intergenic
1157291738 18:46414594-46414616 GTGTGTGCATGGTGTAGGTATGG - Intronic
1157947299 18:51994881-51994903 GTGTGTGTGTGTTTAGGGTAAGG - Intergenic
1158280535 18:55820781-55820803 GTGTCTGTGTGGTTGGGGTAGGG - Intergenic
1158533545 18:58285333-58285355 GTGTGTGTGTGTTTGAGATAGGG + Intronic
1158709114 18:59821322-59821344 GTGTGTGTGAAGTGTATGCATGG + Intergenic
1160400348 18:78606291-78606313 GTGTGTGTGTAGTGTGTGTGGGG - Intergenic
1160415048 18:78703930-78703952 GTGTGTGTGTAGTGTGTGTGTGG + Intergenic
1160415095 18:78704294-78704316 GTGTGTGTGTAGTGTGTCTATGG + Intergenic
1162387184 19:10366692-10366714 GTGTTAGTGTATTTTATGTAGGG - Intronic
1162463475 19:10827081-10827103 GTGTGTGTGTGTTTTAAATAGGG - Intronic
1162696680 19:12482126-12482148 GTGTGTGTGTATTTTAGAGGTGG - Intronic
1163336045 19:16672379-16672401 GTGTGAGTGTATTTTATGTGAGG - Intronic
1163994289 19:21028666-21028688 GTGTGTGTGTGGTTTTTTTAGGG + Intronic
1164540438 19:29117874-29117896 GTGTGTGTGTGTTATAGGTTGGG + Intergenic
1164907746 19:31981355-31981377 GTGTTAGTGTATTTTATGTATGG - Intergenic
1164966078 19:32485417-32485439 GTGGGTGTGTGGTTTTGGTTGGG + Exonic
1165556996 19:36642742-36642764 GTGTGTGTGTGTTTTTGGTGGGG + Intronic
1166140731 19:40803824-40803846 GTGTGTGTGTAGTGGGGGTGGGG + Intronic
1166662276 19:44654775-44654797 GTGTTAGTGTATTTTATGTATGG + Intronic
1166864593 19:45828211-45828233 GGGTGTGGGTATTTTAGATATGG + Intronic
1167116169 19:47490365-47490387 GTGTGTGTGTAGTGTGTGTGGGG + Intronic
1167978352 19:53251651-53251673 GTGTGTGTGTGGTAGAGGCAGGG - Intronic
1168450457 19:56462476-56462498 GTGTGTCTCCAGGTTAGGTAGGG - Intronic
925413115 2:3651429-3651451 GTGTGTGTGTGTGTTAGGAAGGG + Intergenic
925642761 2:6002755-6002777 GTGTTGGTGTATTTTATGTATGG - Intergenic
925873453 2:8291417-8291439 GTGTGTGTGTGTGTTAGATATGG - Intergenic
926024571 2:9529957-9529979 GTGTGTGTGTATTTTTGAGATGG - Intronic
926165182 2:10518162-10518184 GTGTGTGTGTAGTATGTGTGTGG - Intergenic
926522786 2:13937252-13937274 GTGTGTGTGTAGTAGGGGTTGGG + Intergenic
928032314 2:27791601-27791623 GTGTGTGTGTAGATTTATTATGG - Intronic
928189646 2:29151427-29151449 GTGTGTGTGTGTGTTAGGGAAGG + Intronic
928254084 2:29707017-29707039 GTGTGTGTGTGTGTTGGGTAAGG + Intronic
928333314 2:30374428-30374450 GTGTGTGTGGTGTGTATGTAAGG - Intergenic
928817372 2:35315028-35315050 GTGTGTGTGTGTGTTAGGGAGGG - Intergenic
928996657 2:37299499-37299521 GTGTGTGTGTATTTTAGTAGAGG - Intronic
929878560 2:45817099-45817121 GTGTGTGTGTGTTGTGGGTAGGG + Intronic
929996144 2:46827303-46827325 GTGTGTGTGTGGTGTTTGTAGGG - Intronic
930236014 2:48889628-48889650 TTGTGTGTGTGGGTGAGGTATGG + Intergenic
930383225 2:50658428-50658450 GTGTGTGTGTGTTTGAGGCAGGG + Intronic
930614054 2:53574856-53574878 GTGTTAGTGTATTTTATGTATGG - Intronic
930991454 2:57660981-57661003 GTGTGTGTGTATTTTTAGTGTGG - Intergenic
931227389 2:60343306-60343328 GTGTGTGTGATGTCTAGGTATGG - Intergenic
931660634 2:64559266-64559288 GTATGTGTGGAGGTTAGGGAGGG + Intronic
932163871 2:69488168-69488190 GTGTGTGTGTGTTTGAGGGAGGG + Intronic
932222214 2:70008667-70008689 GTGTTAGTGTATTTTAGGTGTGG + Intergenic
932423979 2:71617668-71617690 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424000 2:71617780-71617802 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424005 2:71617808-71617830 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424014 2:71617858-71617880 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424047 2:71618092-71618114 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424058 2:71618160-71618182 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424066 2:71618210-71618232 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424098 2:71618413-71618435 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932424114 2:71618514-71618536 GTGTGTGTGTGGTAGAGGTGGGG + Intronic
932682864 2:73841609-73841631 GTGTTAGTGTATTTTATGTATGG + Intronic
932725439 2:74176071-74176093 GTGTGTGTGTAGTAGAGGCGGGG - Intronic
933121257 2:78541499-78541521 GTGTGTGTGTTGGTTTGGGATGG - Intergenic
933751289 2:85603404-85603426 GTGTCAGTGTAGAGTAGGTAAGG + Intronic
933849826 2:86356930-86356952 GTGTCAGTGTATTTTATGTATGG - Intergenic
934712817 2:96527039-96527061 GTGTTAGTGTATTTTACGTATGG + Intergenic
934753071 2:96806494-96806516 GTGTGTGTGTTGGATAGCTAGGG - Intronic
935715620 2:105936673-105936695 GTGTGTGTGTGTGTTGGGTAGGG - Intergenic
935872058 2:107461582-107461604 GTGTGTGTGTATTTGGGGCAGGG + Intergenic
935970381 2:108524974-108524996 GTGTGTGTGTGGTGTAAGTGTGG + Intergenic
936978067 2:118238839-118238861 GTGTGTGTGTATGTGAGATAGGG + Intergenic
937045361 2:118848342-118848364 GGGTGTGTGTAGTGGAGGGAGGG + Intergenic
937117289 2:119417005-119417027 GTGTGTGTGTATTTCAGACATGG - Intergenic
937177120 2:119949858-119949880 GTGTGTGTGTATTTCAGACAGGG - Intronic
937563862 2:123259775-123259797 GTGTTAGTGTATTTTAGGTGTGG - Intergenic
938017643 2:127880759-127880781 GTGTGTGTATACTGTATGTAGGG - Intronic
938604994 2:132883193-132883215 GTGTGTGTGTATTTGAGTCAGGG - Intronic
938859811 2:135356720-135356742 GTGTGTTTGTTTTTTAGATAGGG + Intronic
939352945 2:141064307-141064329 GTGTTTGGGAAGTTTAGTTATGG + Intronic
939468581 2:142590137-142590159 GTGTGTGTGTATTTGAGACAAGG + Intergenic
939473255 2:142652364-142652386 GTATGTGTGTAGTATAGTAATGG - Intergenic
940328146 2:152446760-152446782 GTGTGTATGGTGTTTAAGTAGGG + Intronic
940358097 2:152767651-152767673 GTGTGTGTGTATTTTAGAAGGGG + Intergenic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941268269 2:163391633-163391655 GTGTGTGTGTAGTAGAGATGGGG + Intergenic
941706620 2:168665071-168665093 GTGTTTGTGTAGGTTAGATTTGG - Intronic
942929266 2:181470322-181470344 GTGTCAGTGTACTTTACGTATGG + Intronic
943349573 2:186781407-186781429 GTGTTTGTGTATTTTATGTGTGG + Intergenic
943512602 2:188844185-188844207 GTGTGTGTGTGTTTTAAATATGG - Intergenic
943541655 2:189222749-189222771 TTGTGTTTGTAGTTTAGGAAAGG + Intergenic
943961149 2:194264976-194264998 GTGTGTGTGTGTTTTGGGTGGGG - Intergenic
944316858 2:198293361-198293383 GTGTGTGTGTATTTCATTTAGGG + Intronic
944571375 2:201048542-201048564 GTGTTAGTGTATTTTATGTATGG + Intronic
944908450 2:204285839-204285861 GTGTTAGTGTATTTTATGTATGG + Intergenic
945034251 2:205690567-205690589 GTGTGTGTGTATTTTTAGCAGGG - Intronic
945249398 2:207751551-207751573 CTGTGTGTGTATTTTTAGTAGGG - Intronic
945598630 2:211829264-211829286 GTGTGTGTGTATGTTATATATGG - Intronic
945599874 2:211847672-211847694 GTGTTAGTGTATTTTATGTATGG + Intronic
945730553 2:213527138-213527160 GAGGATGTGTAGTTTAGGGAAGG + Intronic
945932536 2:215869849-215869871 GTGTGTGTGTTGGGTAGGAAAGG + Intergenic
946583410 2:221156246-221156268 GTGTGTGTGTGTTTAAGATATGG + Intergenic
947104495 2:226654382-226654404 GTGTGTGTGTATTTATTGTAAGG - Intergenic
947302369 2:228702438-228702460 GTGTGTGTGTATTTGAGACAGGG + Intergenic
947315961 2:228858740-228858762 CTATGGGTGTAGTATAGGTAAGG - Intronic
947336853 2:229095124-229095146 GTGTTTGTGTGGTTTAGGTTAGG - Intronic
947610461 2:231522152-231522174 GTGTGTGTGTATTGTAGAGACGG + Intergenic
948637209 2:239346804-239346826 GTGTGTGTGTGTTTTAGACAGGG - Intronic
948637215 2:239346858-239346880 GGGTGTGTGTGTTTTAGATAGGG - Intronic
948637221 2:239346912-239346934 GTGTGTGTGTGTTTTAGACAGGG - Intronic
1169808368 20:9582681-9582703 GTGTGTGTGTGGTGGGGGTAGGG + Intronic
1169857636 20:10121058-10121080 GTGTGTGTGTATTTGAGACAGGG + Intergenic
1170613334 20:17931044-17931066 GTGTGTGTGTAGCTGGGGTATGG + Intergenic
1170898503 20:20437574-20437596 GTGTGTGTGAAGTGTGGGAAGGG - Intronic
1171775273 20:29360954-29360976 GTTTGTTTGTAGTTTACTTATGG - Intergenic
1172089946 20:32423405-32423427 GTGTGTGTGTATATTTAGTAGGG + Intronic
1172434525 20:34919609-34919631 GTGTGTGTGTGTATTATGTAGGG + Intronic
1172769572 20:37372176-37372198 GTGTGTGTGTTTTTTAGAGATGG + Intronic
1173185487 20:40836931-40836953 GTGTATGTGGAGTTTAGGGTGGG - Intergenic
1173519119 20:43686227-43686249 GTGTGTCTGTTGTGTAGGTGGGG + Intronic
1174237315 20:49104562-49104584 TTGTGTGTGCACTGTAGGTAAGG + Intergenic
1174736562 20:52971538-52971560 GTGTGTGTGTATTTTAGGTGAGG + Intergenic
1174951737 20:55049796-55049818 GTTTTTGTGTGGTTTTGGTATGG - Intergenic
1175425750 20:58864916-58864938 GTGTGTGTGTCTGGTAGGTAGGG - Intronic
1175793187 20:61755260-61755282 GTGTGTGTGTGGTATTGATATGG - Intronic
1176130908 20:63496459-63496481 GTGTGTGTTTTTTTAAGGTAAGG + Intronic
1176426522 21:6552143-6552165 GTGTGTGTGTGGTATATGTGTGG - Intergenic
1176426532 21:6552223-6552245 GTGTGTGTGTGGTATACGTGTGG - Intergenic
1177104728 21:16941392-16941414 GTGTGTGTGTGGTTTCCATAAGG + Intergenic
1177603542 21:23347905-23347927 GTGTGTGTATAGCTTAAGCATGG - Intergenic
1177883122 21:26717790-26717812 GTGTGTGTGTAGGTGGGGTAAGG + Intergenic
1177930545 21:27277683-27277705 GTGTGTGTATCCTGTAGGTATGG + Intergenic
1178135073 21:29618118-29618140 CTGTCTCTGAAGTTTAGGTAAGG - Intronic
1178154363 21:29833756-29833778 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1179000935 21:37457407-37457429 GTGTGTGTTTAGTAGAGGTGGGG + Intronic
1179263600 21:39781521-39781543 GTGTGTATGTAGTTTTGTCACGG + Intronic
1179391252 21:40994041-40994063 GTGTGTGTGTGGTGTATGTGTGG - Intergenic
1179480321 21:41672785-41672807 GTGTGTGTGTAGTTTGCATATGG - Intergenic
1179504176 21:41829063-41829085 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1179520982 21:41944342-41944364 GTGTGTGTGTATTTTTAATAGGG - Intronic
1179556758 21:42183536-42183558 GTGTGTATGTAGTGTCTGTATGG + Intergenic
1179556826 21:42184286-42184308 GTGTGTGTGTGGTGTATATATGG + Intergenic
1179702013 21:43160465-43160487 GTGTGTGTGTGGTATATGTGTGG - Intronic
1179702023 21:43160545-43160567 GTGTGTGTGTGGTATACGTGTGG - Intronic
1179751059 21:43467953-43467975 GTGTGTGTGTGGTGTAAGTGTGG - Intergenic
1180084200 21:45500425-45500447 GTGTGTGTGGAGTGTGGCTATGG + Intronic
1180101923 21:45591673-45591695 GTGTGTGTGTGGTTTGTGTGTGG - Intergenic
1181995619 22:26879376-26879398 GTGTGTATGTAGATTAAGTAAGG + Intergenic
1182875135 22:33685079-33685101 TTGTGTGTGTGGTTTAGGATGGG - Intronic
1183002266 22:34870727-34870749 ATGTGTGTGTACTTATGGTAGGG - Intergenic
1183014507 22:34974731-34974753 GTGTGTGTGTATGTCAGGGAGGG - Intergenic
1184326985 22:43795898-43795920 GTGTGTGTGTGGTGTATGTGTGG - Intronic
1184654375 22:45933750-45933772 GTGTGTGTGTGGTGTATGTGTGG + Intronic
1184670300 22:46008703-46008725 GTGTGTGTGTTTTGTAGATAGGG + Intergenic
1184965341 22:47967440-47967462 GTGTGTGTGTTGCTTTGCTATGG - Intergenic
1185013891 22:48332490-48332512 GTGTGTGTGTTGTGTGTGTATGG - Intergenic
1185048747 22:48542434-48542456 GTGTGTGTGTGGTGTATGTGCGG + Intronic
1185048776 22:48542848-48542870 GTGTTTGTGTAGAGTATGTATGG + Intronic
1185193171 22:49451714-49451736 GTGTGAGTGTGGTTCAGGCAGGG - Intronic
1185212702 22:49580342-49580364 GTGGGTGTGTGGTGTGGGTATGG - Intronic
1185281812 22:49972906-49972928 TTGTGTGTGGTGTTTATGTATGG + Intergenic
1185351039 22:50338781-50338803 GTGTGTGTGGTGTGTATGTACGG + Intergenic
949124017 3:423668-423690 GTGTGGCTGGAGTTTAGGGAGGG - Intergenic
949958014 3:9286103-9286125 GTGTGTGTGTGTTTGAGATAGGG - Intronic
949976082 3:9461366-9461388 GTTACTGAGTAGTTTAGGTAAGG + Intronic
950340643 3:12241065-12241087 GTGTGTGTGTGGTGTAGGGATGG + Intergenic
950385946 3:12660478-12660500 GTGTGTGTGTATTTTTTGTAGGG + Intronic
950616885 3:14166971-14166993 GTGGTTGTGTATTATAGGTAAGG - Intronic
950663040 3:14478686-14478708 TTATTTGTGTAGTCTAGGTAGGG - Intronic
950806404 3:15606988-15607010 GTGTTAGTGTATTTTATGTATGG + Intronic
950822663 3:15777837-15777859 GTGTGTGTGTAGTTTGGTTTTGG - Intronic
951246837 3:20350799-20350821 GTGTGTGTGTATATTAGCCAAGG - Intergenic
951887191 3:27535943-27535965 GTGTGTGTGTTGTTTTGCTTTGG - Intergenic
952525106 3:34201772-34201794 GTGTGTGTGTGTTTTGGGGAGGG + Intergenic
953399161 3:42597745-42597767 GTGTTAGTGTATTTTATGTATGG + Intronic
953660996 3:44891500-44891522 GTGTGTGTGTAGAGGAGGGAGGG - Intronic
953720062 3:45347415-45347437 GTGTGTCTGTCGATGAGGTAGGG + Intergenic
954087747 3:48259232-48259254 GTGTGTGAGAAGTTTTGGGAGGG - Intronic
954897207 3:53985965-53985987 GAGTGTTTGTATTTTAGGAAGGG - Intergenic
954902265 3:54030190-54030212 GGGTGTGTGTACTTTCTGTAGGG + Intergenic
954944170 3:54403346-54403368 GTGTGTGTGTGTTTGAGATAGGG - Intronic
955111238 3:55952126-55952148 GTGTGTGTGTGTTTTAGAGATGG - Intronic
955950185 3:64235927-64235949 GTGTGTGTGTAGTTGGGGGAGGG + Intronic
956811014 3:72864135-72864157 TTGTGTGTGTATTTTTAGTAGGG + Intergenic
957639816 3:82837730-82837752 GTGTTAGTGTATTTTATGTATGG - Intergenic
957970815 3:87379757-87379779 GTGTTAGTGTATTTTATGTATGG - Intergenic
958443064 3:94179859-94179881 GTGTGTGTGTGTTTGAGGTGGGG + Intergenic
959819620 3:110717612-110717634 GTGTGTGTGCAGTTGGGGAAGGG + Intergenic
959976362 3:112464790-112464812 GTGTGTGTGTGTGTTAGGTGGGG - Exonic
960154649 3:114286902-114286924 GTGTGTGTGTAGTATAAAAAAGG - Intronic
960319906 3:116221869-116221891 GTGTGTGTGTAGGTGAGGGGTGG + Intronic
960330144 3:116349472-116349494 GTGTGTGTGTAGTTTTTTTGGGG - Intronic
960993085 3:123324393-123324415 GTGTGTGTGTGGTTTCTGTGTGG - Intronic
961337743 3:126193020-126193042 GTGTGTGAGTGGTTGAAGTATGG + Intronic
961707539 3:128799627-128799649 GTATGTGTGTAGGTGAGGTGAGG - Intronic
961790128 3:129369749-129369771 GTTTGTGTGTGGTATAGGTGTGG + Intergenic
961790182 3:129370260-129370282 GTGTGTGTGTGGATGTGGTATGG + Intergenic
961790233 3:129370876-129370898 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
962149960 3:132882063-132882085 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
964046894 3:152339361-152339383 GTGTGTGTGTATGATGGGTAGGG + Intronic
964174052 3:153804162-153804184 GTGTGTGTGTGTTTTAAATAGGG - Intergenic
964723027 3:159786749-159786771 GTCTGTGTGTAGTGGAGGGATGG + Intronic
964837032 3:160950452-160950474 TTGTATGTGTAGTTGGGGTATGG - Intronic
966483190 3:180435330-180435352 TTGTGTGTGGATTTTTGGTATGG - Intergenic
966755191 3:183363262-183363284 GAGTATGTGTAGTTTTGTTATGG - Intronic
966808163 3:183822230-183822252 GTGTGTGTGTGTTTTAGAGATGG - Intronic
967004598 3:185372172-185372194 GTGGGTCTGTAATTTAGGTCTGG - Intronic
967142714 3:186575395-186575417 GTGTGTGTGTGTTTTGGGTAGGG + Intronic
967987197 3:195104237-195104259 GTGTGTGTGTATTTTATGAGAGG + Intronic
967987988 3:195109771-195109793 GTGTGTGTGTGGTGTATGTGTGG + Intronic
968006441 3:195246435-195246457 GTGTGTCTGTCTTGTAGGTACGG + Intronic
968177931 3:196567773-196567795 GTGTGTGTGTGTGTGAGGTAGGG + Intronic
968362009 3:198153860-198153882 GTGAGTGTTTAGCTTAGGTGTGG + Intergenic
969156432 4:5214590-5214612 GTGTGTGTGTAGTGCAGGGTTGG - Intronic
970046015 4:11855220-11855242 GTGTTTGTGTATTTTATGTGTGG + Intergenic
970399507 4:15703782-15703804 GTGTGTGTGTTCTAGAGGTAAGG + Intronic
970399579 4:15704376-15704398 GTGTGTGTGTTCTAGAGGTAAGG + Intronic
971038055 4:22716939-22716961 GTGTGTGTGTGTGTTAGTTAGGG + Intergenic
971038057 4:22716943-22716965 GTGTGTGTGTTAGTTAGGGAGGG + Intergenic
971221624 4:24712830-24712852 GTGTGTGTGGTGTTTAACTAGGG + Intergenic
971439554 4:26665779-26665801 GTGTGTGTGTGTTTCAGGAAAGG + Intronic
971593790 4:28501424-28501446 GTGTGTGTGTAGTTTCTGTTTGG - Intergenic
971707990 4:30072827-30072849 GTGTGTGTGTGGTCTAATTAAGG - Intergenic
972057037 4:34815777-34815799 GTGTGTGTGTGTTTTAGTTTGGG - Intergenic
973610963 4:52635708-52635730 GGGTGTGTGTATTTTTGATATGG - Intronic
974249632 4:59368384-59368406 GTGTGTGTGTGTTTTAGCGACGG + Intergenic
974473816 4:62354533-62354555 GTGTGTGTGTATTAGTGGTAAGG + Intergenic
975244090 4:72098509-72098531 GTGTTAGTGTAGTTTATGTGTGG + Intronic
976325422 4:83765824-83765846 GTGTGTGTGTATTTAATGTCAGG - Intergenic
976337097 4:83901772-83901794 GTGTGTGGGAATTTTAGGCATGG - Intergenic
976773925 4:88686162-88686184 GTGTGAGTGTATTTTATGTGTGG + Intronic
977089584 4:92653292-92653314 GTGTGTGTGTAATTTTGGCCAGG - Intronic
977701176 4:100024570-100024592 ATGTGTTTGTTGTTTAGGCAGGG - Intergenic
977986033 4:103384800-103384822 GTGTGTGTGTAGTAAAAATAGGG - Intergenic
978296814 4:107215038-107215060 ATATGTGGGTGGTTTAGGTAAGG - Intronic
978589639 4:110311015-110311037 GTGTATGAGTAGTTGAAGTATGG + Intergenic
978860890 4:113447643-113447665 CTGTGTGTGTAATTTAGGAGAGG + Intergenic
980104024 4:128570152-128570174 GTGTGTGTGTGGTTGAGGGGTGG - Intergenic
980797981 4:137710687-137710709 GTGTATGTGTTGGTTGGGTAGGG + Intergenic
982440493 4:155429935-155429957 GTGTGTGTGTTGTGTATGTGTGG + Intergenic
982699015 4:158638448-158638470 GTGTGTGTGTGGTACAAGTAAGG - Intronic
982778640 4:159467271-159467293 GTGTGTGTGTTGGGTAGGTATGG - Intergenic
983436164 4:167718604-167718626 GTGTTTGTGTATTTTATGTGTGG + Intergenic
983467724 4:168115478-168115500 GTGCGTGTGTATTGTAGGGAGGG - Intronic
983529887 4:168799161-168799183 GTGTGTGAGTGGTTGAGGTATGG + Intronic
984260168 4:177435686-177435708 GTGTGTGTGTATTTTGGGGTAGG - Intronic
985124250 4:186675733-186675755 GTGTGTGTGTGTTTTAGACAGGG - Intronic
985124254 4:186675772-186675794 GTGTGTGTGTGTTTTAGACAGGG - Intronic
985357195 4:189134081-189134103 GTGTGTGTGTGTTTTAGTCATGG + Intergenic
985392575 4:189505300-189505322 GTGTGTGTGTAGTTGTGGGCTGG - Intergenic
985922871 5:2993153-2993175 GTGTTAGTGTATTTTACGTATGG - Intergenic
986475862 5:8131631-8131653 GTGTGTGTGTTCTTTAGGAAGGG - Intergenic
986793046 5:11181979-11182001 GTGTGTGTGTAGTATGTGTGTGG + Intronic
986793084 5:11182206-11182228 GTGTGTGTGTAGTGTGTGTGTGG + Intronic
987807449 5:22787298-22787320 GTGTGCCTTTAGTTTAAGTATGG - Intronic
987954036 5:24714844-24714866 GTGTGTGTGTGTTATAGGAAAGG + Intergenic
988279890 5:29131307-29131329 GTGTGTGTGTCTTTATGGTAGGG - Intergenic
989589523 5:43100546-43100568 GTGTGTGTGTATTTTTAGTAGGG + Intronic
989707325 5:44351835-44351857 GTGTGTGTGTAATTTAAAAAAGG - Intronic
989815094 5:45726590-45726612 GTGTGTCTGTAGTATTGATAGGG - Intergenic
990061691 5:51658078-51658100 GTGTGTGTGTAGTGAATGAAAGG + Intergenic
990122190 5:52468923-52468945 GTGTGTGTGTATTTTATGTAAGG + Intergenic
990324443 5:54661060-54661082 GTGTTAGTGTATTTTATGTATGG + Intergenic
990442916 5:55864730-55864752 GTGTGTGTGTAGTGTGTGCAGGG - Intronic
990931838 5:61100526-61100548 GTGTGTGTGTGTATTAGGGAGGG - Intronic
991000395 5:61777104-61777126 GTGTGTGTGTGGTTTGGGGAAGG - Intergenic
991071915 5:62492708-62492730 ATTTTTGTGTAGTTTTGGTAGGG + Intronic
991375526 5:65962399-65962421 ATGTGTGTGTAATTTGGGTGTGG + Intronic
992176928 5:74158375-74158397 ATCTGTGAGTAGTTCAGGTATGG - Intergenic
992383015 5:76257281-76257303 GTGTGTGTGTAGTGTGTGTGTGG + Intronic
992383016 5:76257292-76257314 GTGTGTGTGTGGTATCTGTATGG + Intronic
992383018 5:76257321-76257343 GTGTGTGTGTGGTATCTGTATGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993106144 5:83603206-83603228 GTGTTAGTGTATTTTATGTATGG - Intergenic
993866817 5:93205648-93205670 GTGTGGCTGTAATTCAGGTAAGG + Intergenic
994006405 5:94842334-94842356 GTGTGTGTGTAATTTTGATGTGG - Intronic
994017212 5:94981434-94981456 GTGTGAGTGTATTTCAGGAAAGG - Intronic
994082526 5:95723141-95723163 GTGTTAGTGTAGTTTATGTGTGG - Intronic
994206513 5:97042381-97042403 GTGTATGTGTAATTTGGGTGAGG - Intergenic
994210246 5:97079795-97079817 GTGTGTGAGTGGTTGAAGTATGG - Intergenic
994570693 5:101509602-101509624 GTGTGTGTGTGTTTTAGTAACGG + Intergenic
994992329 5:107012896-107012918 GTGTGTTTCAAGTATAGGTAGGG - Intergenic
995648625 5:114342439-114342461 GTGTGTGCGTATTGGAGGTAGGG + Intergenic
995828402 5:116327526-116327548 GTGTGTGTGTAGTATGTGTGTGG - Intronic
996916897 5:128722909-128722931 GTGTAGGTGCAGTTTGGGTATGG - Intronic
997504609 5:134407248-134407270 GTGTGTGTGTGTGTTAGGAAGGG - Intronic
997787562 5:136727607-136727629 GTGTTAGTGTACTTTATGTAGGG - Intergenic
997941231 5:138159355-138159377 GTGTGTGTGTGGGCTGGGTAGGG - Intronic
998134958 5:139669734-139669756 GTGTGTGTGTAGCTTGGCTGTGG - Intronic
998646658 5:144069460-144069482 GTGTGTGTGTAGTAGAGACAGGG - Intergenic
998806447 5:145921681-145921703 GTGTGTATGTATTTTGGGTGAGG - Intergenic
998957388 5:147452426-147452448 GTGTGTGTGTAGTGGGGGAATGG - Intronic
999324445 5:150634817-150634839 GTGTGTGTGTGTTTTAGACAGGG - Intronic
999442413 5:151612717-151612739 GTGTGTGTGTGGTGTATGTGTGG + Intergenic
1000236588 5:159367147-159367169 GTGTGTGTGTGGTGTGAGTATGG + Intergenic
1000367490 5:160505155-160505177 GTGTGTGTGTGGGGTATGTATGG + Intergenic
1000579386 5:163016648-163016670 GTGTGTGTTTTGTTTTGGTTTGG + Intergenic
1000790423 5:165600091-165600113 GTGTGTGTGTATGTTAGAGAGGG - Intergenic
1001233769 5:170012577-170012599 GTGTGTGTGGAGAGGAGGTATGG + Intronic
1001550180 5:172596964-172596986 GTGTGTGTGGTGTATATGTATGG - Intergenic
1001550206 5:172597318-172597340 GTGTGTGTGTAGTGTGTGTGTGG - Intergenic
1001621481 5:173089204-173089226 GTGTGTGTGTTGTCTGTGTATGG - Intronic
1001623000 5:173104747-173104769 GTGTGTGTGTATTTTTGTGATGG + Intronic
1001676731 5:173524688-173524710 GTGTGTGTGTATTTTATCAATGG - Intergenic
1002146619 5:177188158-177188180 GTTTGTGTGTAGTTGAATTATGG + Intronic
1002613255 5:180435278-180435300 GTGTGTGTGTGGTTGATGTGAGG + Intergenic
1002710784 5:181193764-181193786 GTGTGTGTGTATTTTGGAGAGGG - Intergenic
1002866698 6:1128134-1128156 GTGTGTGTGTGGTTTGGGGATGG + Intergenic
1003549487 6:7090300-7090322 GTGTTAGTGTATTTTATGTATGG - Intergenic
1003893920 6:10589092-10589114 GTGTGTGTGTAGTGTGTGTGTGG + Intronic
1004016458 6:11736210-11736232 GTGTGTGTGTGTTTTAGGAGAGG - Intronic
1004496648 6:16170086-16170108 GTGTTAGTGTATTTTATGTATGG + Intergenic
1005321811 6:24662985-24663007 GTGTGTGTGCCGGATAGGTAAGG - Intronic
1005808011 6:29493229-29493251 GTGTGGCTGAAGTTTAGGGAGGG + Intergenic
1005834959 6:29702126-29702148 GTGTGTGTGTAGATCAGGAGGGG - Intergenic
1006509072 6:34512085-34512107 GTGTGTGTGTACATGATGTAGGG + Intronic
1006861832 6:37176826-37176848 GTGTGTGTGTGTTTTAAGTGGGG - Intergenic
1006927423 6:37664832-37664854 GTGTGTGTGTGTCTTAGGTTAGG - Intronic
1008549655 6:52615632-52615654 GTGTGTGTAGGGTATAGGTAGGG + Intergenic
1008552146 6:52643526-52643548 GTGTGTGTGCTGTGTAGGTTTGG + Intergenic
1008869454 6:56255367-56255389 GTGTGTGTTTAGTGTTTGTATGG + Intronic
1010145793 6:72668469-72668491 GTGTGTGTGTGTTTTGGGTGAGG + Intronic
1010833409 6:80557412-80557434 GTGTATGTGTAGTAGAGATAGGG - Intergenic
1011662752 6:89608344-89608366 GTGTGTGTGTGTATTAGGGAGGG - Intronic
1012082355 6:94776715-94776737 GTGTGTGTGTATGTGAGGTTTGG + Intergenic
1013503782 6:110778846-110778868 GTGTGTCTGTAGTTCAAATATGG + Intronic
1013867215 6:114713187-114713209 GTGTGTGTGTATATGAGATATGG - Intergenic
1014522983 6:122467830-122467852 GTGTGTGTGTGATTTTGGTGGGG + Intronic
1014867268 6:126547947-126547969 GTTTATGTGTGGTTTAGGTGTGG + Intergenic
1015036518 6:128661903-128661925 GTGTTTGTGTATTTTATGTGTGG + Intergenic
1015888795 6:137948262-137948284 GTGTGTGTGTGTTCCAGGTATGG - Intergenic
1017120395 6:151018659-151018681 GTGTGTGTGTATTGGAGGTCTGG + Intronic
1017258299 6:152359644-152359666 GTGTGTGTGTATTTTATGTCTGG + Intronic
1017315536 6:153027195-153027217 GTGTCTGTGTAGCATAGGTTTGG + Intronic
1017490670 6:154941980-154942002 GTGTGCATGTAGTAAAGGTAAGG - Intronic
1017866232 6:158445735-158445757 GTGTGTGTGTTGCTCAGGAAAGG + Intronic
1018037674 6:159895175-159895197 GTGTGTGTGTATGTTGGGTGGGG + Intergenic
1018134314 6:160764934-160764956 GTGTGTGTGTGGTATGTGTATGG + Intergenic
1018462090 6:164008021-164008043 GTGTCAGGGTATTTTAGGTAAGG - Intergenic
1018568320 6:165181631-165181653 GTGCGTGTGTACTTTAGAGAGGG - Intergenic
1018815409 6:167326765-167326787 GTGTGAGTGTATTTTATGTGTGG + Intronic
1019253669 7:34847-34869 GTGAGTGTTTAGCTTAGGTGTGG - Intergenic
1019703295 7:2485043-2485065 GTGTGTGTGTGTTTGAGGCAAGG - Intergenic
1020112556 7:5455739-5455761 GTGTGTGTGTAGTGGGGGTGGGG - Intronic
1020806338 7:12794819-12794841 GTGTGTGAGTTGTATAGGTGTGG - Intergenic
1020810980 7:12849591-12849613 TTCTGTATGTAGTTTAGGCAGGG + Intergenic
1020849548 7:13333819-13333841 GTGTGTGTGTAGGTGGGGCAAGG - Intergenic
1021158438 7:17241340-17241362 GTGTGTGTGTGTTTTAGCTGTGG - Intergenic
1021328856 7:19309597-19309619 GTGTGTGTGCAGGACAGGTAAGG + Intergenic
1022856041 7:34315630-34315652 GTGTGTGTGTGTTTTAGATGAGG + Intergenic
1023583314 7:41704648-41704670 GTGTGTGTGTAGGTGACGTGGGG + Intergenic
1023689062 7:42767287-42767309 GTGTGTGTGTGGTTTGTGTGGGG - Intergenic
1023994917 7:45153571-45153593 GTGTGTGTGTGGTGTATGAATGG - Intergenic
1024039826 7:45543651-45543673 GTGTGTGTGTGGATTGGGTCAGG + Intergenic
1025242815 7:57292060-57292082 GTGTTAGTGTATTTTATGTATGG + Intergenic
1025281866 7:57632331-57632353 GTGTGTGTGTATTTGAGATGGGG + Intergenic
1025302863 7:57833186-57833208 GTGTGTGTGTATTTGAGATGGGG - Intergenic
1025810604 7:64873064-64873086 GTGTGTGTGTAATTGGGGTCTGG + Intronic
1026066580 7:67079190-67079212 GTGTGTGTGTGTTTTAGGTTTGG + Intronic
1026710335 7:72733149-72733171 GTGTGTGTGTGTTTTAGGTTTGG - Intronic
1027154334 7:75755875-75755897 GTGTGTGTGTAGTAGAGATGGGG - Intergenic
1027170352 7:75867293-75867315 GTGTGTGTGTATGTTAGACAGGG + Intronic
1027780757 7:82517124-82517146 GTGTGTGTGTATTTTGGGAAAGG + Intergenic
1027793896 7:82668117-82668139 GTGTGGCTGTAGTTGAAGTAAGG - Intergenic
1027974070 7:85126429-85126451 GTGTGTGTGTAGGTTGGGGAAGG + Intronic
1028276136 7:88859207-88859229 GTGTGTGTGCTGTTTCTGTATGG + Intronic
1028326486 7:89532895-89532917 GTGTGTGTGTAGTGGTAGTAAGG + Intergenic
1029080649 7:97971682-97971704 GTGTGTGTGTAAGTTAGTTACGG - Intergenic
1029293013 7:99516995-99517017 GTGTTTGTGTATTTTATGTGTGG - Intronic
1029311512 7:99671155-99671177 GTGTGTGTGTATTTTATGTGTGG + Intronic
1029615142 7:101651579-101651601 GTGTTAGTGTATTTTAGGTGTGG - Intergenic
1030464615 7:109884633-109884655 ATGTATGTGTGGTTTAGGTCTGG - Intergenic
1030626362 7:111849936-111849958 GTGTGTGTGGAGTTAGGGTAGGG - Intronic
1030738037 7:113073813-113073835 GTGTGTGTGTATTTATGGAATGG + Intergenic
1031198410 7:118646262-118646284 GTGTGTGAGTGGTTGATGTATGG + Intergenic
1031460736 7:122045671-122045693 GTGTGTGTGTAATTTATTTAGGG - Intronic
1031489179 7:122366598-122366620 GTGTGTGTGTATTTTTGAGATGG - Intronic
1031648769 7:124259970-124259992 GTGTGAGAGTAGTTTGGATAGGG - Intergenic
1033189625 7:139265581-139265603 GTGTGTGTGTGATTAAGTTAAGG + Intronic
1033799474 7:144882823-144882845 CTGTCTGTGTAGGTTGGGTAGGG + Intergenic
1033958007 7:146875871-146875893 GTGTGTGTGTGTTTAAGATAAGG - Intronic
1033969425 7:147021230-147021252 TAGTGTGTGTATTTTATGTATGG + Intronic
1034053906 7:148014375-148014397 GTCTGTGTGAAGTTTTGTTACGG - Intronic
1034078823 7:148257912-148257934 GTGTGTGTGTGTTTAAGGTGTGG - Intronic
1034406895 7:150910287-150910309 GTGTGTGTGTAGTGTGTGTGTGG + Intergenic
1034700786 7:153094000-153094022 GTGTGTGTGTAGAGTGGGTTAGG - Intergenic
1034745135 7:153517453-153517475 GTGTTTGTGTATTTTATGAAAGG + Intergenic
1035083613 7:156237475-156237497 GTGTGTGTGTGTTTCATGTACGG + Intergenic
1035336501 7:158132733-158132755 GTGTGTGTATAGTGTATGTTGGG - Intronic
1035397481 7:158544698-158544720 GTGTGAGTGTATTTTACGTGTGG + Intronic
1035444567 7:158931617-158931639 GTGTGTGTGTAGTTAAGTACAGG - Intronic
1035653649 8:1288689-1288711 GTGTGTGTGTGGTTCTGTTAGGG + Intergenic
1035842556 8:2828122-2828144 GTGTTAGTGTAGTTTATGTGTGG - Intergenic
1036049054 8:5175327-5175349 TTGTGTGTGTATTTTATTTATGG + Intergenic
1036083973 8:5592343-5592365 TTGTGTGTGTAGTTTGTGTGGGG - Intergenic
1036704714 8:11038539-11038561 GTGTGTGTGTGTTTGAGGCAGGG + Intronic
1037002812 8:13741273-13741295 GTGTGTGTGTATTTCAAGCATGG - Intergenic
1037323295 8:17664382-17664404 GTATGTGTGCAGTTTGGGAATGG - Intronic
1037686462 8:21143665-21143687 CTGTGTGTGTAGATGAGGTAGGG - Intergenic
1037764972 8:21767105-21767127 GTGTGTGTGTATGTGATGTATGG - Intronic
1037986723 8:23294941-23294963 GTGTGTGTCTGGTTTGGGCAGGG + Intronic
1037995187 8:23347144-23347166 GTGTGTGTTTAGTAGAGATAGGG - Intronic
1038150557 8:24939553-24939575 GTGTGTGTGTACTTGAGACAGGG + Intergenic
1038993091 8:32891062-32891084 GTGTGTGTGTAGTTTGTATTAGG + Intergenic
1039057363 8:33547650-33547672 GTGTGTGTTTGATTTGGGTATGG + Intergenic
1039318339 8:36398396-36398418 GTGTTAGTGTATTTTATGTATGG - Intergenic
1039361450 8:36881568-36881590 GTGTGTGTGGAGACTAGGTGAGG - Intronic
1039492015 8:37954970-37954992 ATGTGTCTGGAGTTCAGGTACGG + Intergenic
1039557739 8:38488722-38488744 GTGTGTGTGTTGTGGAGGGAGGG - Intergenic
1039759737 8:40561807-40561829 GTGTTCGTGTATTTTATGTATGG + Intronic
1039819714 8:41124966-41124988 GTGTTAGTGTATTTTATGTATGG + Intergenic
1040677503 8:49768004-49768026 GTGTGTGTGTGGTATATGAATGG - Intergenic
1041097776 8:54366436-54366458 GTGTGTGTGTAGTGTGTGTGTGG + Intergenic
1041330357 8:56717525-56717547 GTGTGTGTGTATTTAGGGGAGGG - Intergenic
1041342513 8:56860647-56860669 GTGTGTGTGTGCTTTAGGTGTGG - Intergenic
1041439334 8:57877067-57877089 GTGTGTGTGTGTTTAAGATATGG - Intergenic
1041844028 8:62306581-62306603 GTGTGTGTTTAGTTTATGTGTGG + Intronic
1042034264 8:64514053-64514075 GTGTATGAGTAGTTGAAGTAGGG - Intergenic
1042173919 8:66020642-66020664 GTGTGTGTGTGTTTTAGACAAGG + Intergenic
1042193682 8:66213466-66213488 GTGTTTGTGTATTTTATGTGTGG + Intergenic
1043196060 8:77293056-77293078 GTGTGTGTGTACAATGGGTATGG - Intergenic
1043266601 8:78273960-78273982 GTGTTAGTGTATTTTATGTATGG - Intergenic
1043483938 8:80680388-80680410 TTGTGTGTGTGGTTTTGGAATGG + Intronic
1043513424 8:80972957-80972979 GTGTGTGTGTAGTTTATTACTGG + Exonic
1043713001 8:83446243-83446265 GTGTGTGTGTGTGTTAGGTTAGG + Intergenic
1044725544 8:95191616-95191638 GTGTGTGTGTAGTATGGAGAGGG + Intergenic
1045716227 8:105048843-105048865 GTGTGTGTGTTTTTGAAGTAAGG - Intronic
1045851258 8:106701246-106701268 GTGTGTGTGCAGTTTGGTGAGGG - Intronic
1046020635 8:108660474-108660496 GTGTGAGTGAAGTTTTGGGAAGG - Intronic
1047362251 8:124179730-124179752 GTGTGTGTGGTGTTTGGGTGGGG + Intergenic
1047782506 8:128121611-128121633 GTGTGTGTGTAGTAGGTGTATGG - Intergenic
1048082210 8:131140655-131140677 TTGTGTGTGTAGTTTTTCTATGG + Intergenic
1048261803 8:132951620-132951642 GTGTGTGTGTATTGTGGGTGAGG + Intronic
1048293064 8:133195188-133195210 GTGTGTGTGTGGTGTGTGTATGG + Intronic
1048660666 8:136596872-136596894 GTGTGTGTATAGTAGAGGCAAGG - Intergenic
1050087302 9:1979333-1979355 GTGTGTGTGGTATTTGGGTAGGG - Intergenic
1050598702 9:7229219-7229241 GTGTGTGTGCATATTAGGGATGG + Intergenic
1050631860 9:7568169-7568191 GTGTGTGTGTATGTTTGGTTGGG + Intergenic
1050658818 9:7860184-7860206 GTGTGTGTTTAGTTGAAATATGG - Intronic
1050860319 9:10421029-10421051 GTGTTAGTGTATTTTATGTATGG - Intronic
1051073225 9:13198773-13198795 GTGTGTGTGTGTTTTAGGACAGG + Intronic
1051138964 9:13956838-13956860 GTGTGTGTGTAGGCAAGATAGGG - Intergenic
1051153085 9:14106657-14106679 ATTTGAGTGTAGTTTAGGAAAGG - Intronic
1051329575 9:16010156-16010178 GTGTGTGTGTACTTTGTGGAGGG + Intronic
1051949300 9:22611745-22611767 GTGTCTGAGTAGTCTAGGTGGGG + Intergenic
1054128113 9:61333959-61333981 GAGTGTGTGTGGGTTAGTTAGGG + Intergenic
1054141374 9:61532987-61533009 TTGTGTGTGTAGTTTGTGTGTGG + Intergenic
1054461065 9:65463423-65463445 TTGTGTGTGTAGTTTGTGTGTGG + Intergenic
1055211156 9:73794150-73794172 GTGGTTGTGTGGTTTATGTATGG + Intergenic
1056177963 9:84053893-84053915 GTGTGTGTGTATTTTAAGATGGG + Intergenic
1056193359 9:84206205-84206227 GTGTGTGTGTGGTGTATGTGTGG + Intergenic
1056380565 9:86053544-86053566 GTGTGTGTGTAGTGTGTGTTTGG - Intronic
1056577902 9:87869986-87870008 GTGTGTGTGTGGTATGGGTGTGG - Intergenic
1056731970 9:89173655-89173677 GTGTGTGTGCAGTGTCTGTATGG + Intronic
1056752039 9:89358837-89358859 GTGTGTCTGTATTTTGGGTAAGG + Exonic
1056859015 9:90162492-90162514 GTGTGTGTGTAGTATGTGTGTGG - Intergenic
1056926816 9:90842242-90842264 GTGTGTGTGTAGTGCAGCTGTGG + Intronic
1056926837 9:90842682-90842704 GTGTGTGTGTAGTGCAGGTGTGG + Intronic
1057022575 9:91711509-91711531 GTGTGTGTGTAGTGTGTGTGTGG + Intronic
1057429014 9:94977586-94977608 GTGTGTGTGTGGTGGAGGCAGGG - Intronic
1057837310 9:98455552-98455574 GTGTGTGTGTGGTGGAGGGAGGG + Intronic
1058533690 9:105932803-105932825 GTATGAGTGTAGCTTAGGGAGGG + Intergenic
1059248048 9:112865033-112865055 GTGTGTGTGTAGTGTGTGTGTGG - Intronic
1059519893 9:114931150-114931172 GTGTGTGTGTATTTGTGGTATGG + Intergenic
1059537317 9:115093412-115093434 GTGGGTCTGTAATGTAGGTAAGG + Intronic
1060171300 9:121463558-121463580 GTGTGTGTGTATTGTAGAGACGG + Intergenic
1060567171 9:124603290-124603312 GTGTGTGTGTTGTGTGGGTGGGG + Intronic
1060662006 9:125409990-125410012 GTGTGTGTGTGGTGTATGTGTGG - Intergenic
1060662012 9:125410064-125410086 GTGTGTGTGTGGTGTGCGTATGG - Intergenic
1061081331 9:128372313-128372335 GTGTGTGTGTAGATAAGCCAAGG + Intronic
1061172612 9:128969169-128969191 GTGTGTGTGTGGTATAGATGGGG + Intronic
1061846284 9:133390184-133390206 GTGTGTGTGTGTTTTAAGTCAGG - Intronic
1061869299 9:133511699-133511721 GTGTATGTGTAGTTTATGGAGGG + Intergenic
1062441063 9:136570061-136570083 GTGTGTGTATTGTTTGGGTGGGG + Intergenic
1062563611 9:137153098-137153120 GTGTGTGTGTGGTGTATGCATGG - Intronic
1185804744 X:3046922-3046944 GTGTTTGTGTATTTTATGCATGG - Intronic
1185822048 X:3214955-3214977 GTGTATGTGTAGTGGAGGGAGGG + Intergenic
1186073603 X:5851541-5851563 GCGTGTGTGTGTTTTAGGGACGG + Intronic
1186327785 X:8498576-8498598 GTGTTTGTGTATTTTATGTGTGG + Intergenic
1186683278 X:11898121-11898143 GTGTGTGTGTATTGGGGGTATGG + Intergenic
1187048267 X:15670928-15670950 GTGTGTGTGTGGTTTCTCTAAGG + Intergenic
1187143190 X:16614063-16614085 GTGTTAGTGTATTTTATGTATGG - Intronic
1188025446 X:25203422-25203444 GGGAGTGTGTGGTTAAGGTAAGG + Intergenic
1188658110 X:32723834-32723856 GTGTTAGTGTATTTTAGGTGTGG - Intronic
1189427491 X:40914232-40914254 GTGTTAGTGTATTTTATGTATGG + Intergenic
1190366909 X:49703756-49703778 GTGTTAGTGTATTTTAGGTGTGG - Intergenic
1191750502 X:64536914-64536936 GTGTGTGTGTATGTTAGTCATGG - Intergenic
1192300409 X:69895383-69895405 GTGTGTGTGTAGGTTGAGAAAGG - Intronic
1192300492 X:69896423-69896445 GTGTGTGTGTAGGTTGAGAAAGG + Intronic
1192440165 X:71168333-71168355 GTGTGTGTGTGTTTAAGATAAGG - Intronic
1192546690 X:72020225-72020247 GTGTGTGTGTATTTTAATGAAGG - Intergenic
1193370953 X:80696507-80696529 GTGTGTGTGTATTTATGTTATGG - Intronic
1193630944 X:83887480-83887502 GTATGTGTGTAGAGGAGGTAAGG - Intergenic
1193763581 X:85496911-85496933 CTGTGTGGGTAGTCTAGGTTAGG - Intergenic
1193867456 X:86753043-86753065 GTGTGTGTGTACTTTTAATAAGG - Intronic
1194653864 X:96547881-96547903 GTGTGTGTGTAGCTGGGGGAAGG - Intergenic
1194930256 X:99879568-99879590 GTGTTTGTGAAGTTTCAGTATGG - Intergenic
1194959667 X:100220733-100220755 GTGTTAGTGTATTTTATGTATGG - Intergenic
1195639016 X:107153799-107153821 GTGTGTGTGTTTTTTCAGTAGGG - Intronic
1195694399 X:107655935-107655957 GTGTGTGTGTATTTTCGGGTAGG + Intergenic
1196949795 X:120866058-120866080 GTGTGTGTGTGTTTAAGGAAAGG + Intergenic
1197869796 X:131054015-131054037 GTGTTAGTGTATTTTATGTATGG - Intergenic
1198306892 X:135392273-135392295 GTGTGTGTGTGTGTTAGGGAGGG - Intergenic
1198420355 X:136465500-136465522 GTGTGTGTGTGTTTTAGAGACGG + Intergenic
1198435744 X:136615439-136615461 GTGTTAGTGTATTTTATGTATGG + Intergenic
1198508248 X:137323109-137323131 GTGTGTGTGTGTTTTTGGTGAGG - Intergenic
1198532042 X:137557125-137557147 GTGTGTGTGTGTTTTAAGGATGG - Intergenic
1199454466 X:148012362-148012384 GTGTGTCTGTAGCTTTGGTAAGG + Intronic
1199691960 X:150315313-150315335 GTGTGTGTATGGTTGGGGTAGGG + Intergenic
1199701858 X:150385265-150385287 GTGTGTGTGTAGTATTGTTCAGG - Intronic
1199738020 X:150703479-150703501 GTGTGTGTGTGGGTGAGGGAAGG - Intronic
1199808529 X:151326669-151326691 GTGTGTGTGTAGTTAGAGTGGGG - Intergenic
1200373541 X:155754968-155754990 GTGTGTGTGTATTTTAAATAGGG + Intergenic
1200686164 Y:6262211-6262233 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1200701422 Y:6405800-6405822 GTGTGTGTGTGGTGTCTGTAAGG - Intergenic
1200991701 Y:9353459-9353481 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1200994356 Y:9373735-9373757 GTGTGTGTGTGTGTTAGATATGG - Intronic
1200997021 Y:9394081-9394103 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1200999535 Y:9462623-9462645 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1201002192 Y:9482931-9482953 GTGTGTGTGTGTGTTAGATATGG - Intronic
1201004855 Y:9503214-9503236 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1201010145 Y:9543759-9543781 GTGTGTGTGTGTGTTAGATATGG - Intergenic
1201032689 Y:9758898-9758920 GTGTGTGTGTGGTGTCTGTAAGG + Intergenic
1201480199 Y:14430515-14430537 GTGTCTGTGTAGTATACATAAGG - Intergenic