ID: 1130863488

View in Genome Browser
Species Human (GRCh38)
Location 15:87911511-87911533
Sequence GTTCCATTTTCACACAATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130863481_1130863488 18 Left 1130863481 15:87911470-87911492 CCCAATGGGGATGGAGAACCCAC 0: 1
1: 0
2: 0
3: 10
4: 127
Right 1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG 0: 1
1: 0
2: 2
3: 13
4: 180
1130863482_1130863488 17 Left 1130863482 15:87911471-87911493 CCAATGGGGATGGAGAACCCACT 0: 1
1: 0
2: 2
3: 7
4: 172
Right 1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG 0: 1
1: 0
2: 2
3: 13
4: 180
1130863486_1130863488 -1 Left 1130863486 15:87911489-87911511 CCACTATCTTGTAGGACGGTCTG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG 0: 1
1: 0
2: 2
3: 13
4: 180
1130863485_1130863488 0 Left 1130863485 15:87911488-87911510 CCCACTATCTTGTAGGACGGTCT 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130863488 Original CRISPR GTTCCATTTTCACACAATAA GGG Intronic
903889386 1:26559333-26559355 GTTCCAGATTCACAAGATAATGG + Intronic
904934245 1:34116788-34116810 GTTACATTTTCCAACTATAAAGG + Intronic
910418927 1:87034503-87034525 GTTCCATATTTACAAAACAAGGG - Intronic
910738292 1:90486808-90486830 TTTCCATTTTCCCCCAATAGAGG + Intergenic
913528254 1:119713679-119713701 GATACAATTTCACACAAGAAAGG - Intronic
917518829 1:175731542-175731564 ATTCAATTTTCACAAAATTATGG + Intronic
917994866 1:180425978-180426000 TTTCCATTTTTAAACAATAATGG - Intronic
1064821139 10:19334655-19334677 TTCCCTTTTTCACATAATAATGG - Intronic
1065544954 10:26809608-26809630 CTTTCATTTTCACATAAAAAAGG + Intronic
1068218536 10:54013287-54013309 CTTCGATTTCCACACAATAGTGG + Intronic
1068246945 10:54384369-54384391 GTTGCATTTTCACTAAAAAAAGG - Intronic
1069029571 10:63581102-63581124 TTTCCCCTTTCACACAATACTGG + Intronic
1069107851 10:64405625-64405647 GTTCCTTTTTCACCCAACTAAGG - Intergenic
1070482247 10:76893955-76893977 TTTCCATTTTTACAAAAAAATGG - Intronic
1071020521 10:81049252-81049274 GTACCATATTAAAACAATAATGG - Intergenic
1076398285 10:130157519-130157541 GATCCATTCTCACCCAATATGGG - Intronic
1077713534 11:4558963-4558985 GATCCATTCTAACACAATTATGG + Intergenic
1082949440 11:58795764-58795786 TTTCCTTTTTTACAAAATAAGGG - Intergenic
1085674718 11:78505363-78505385 ATTTCAGTTTCACATAATAAGGG + Intronic
1086125974 11:83348987-83349009 CTTCTATTTTCACACAATTTTGG - Intergenic
1087183539 11:95161970-95161992 CTACCATTTTCAGACAAGAAGGG + Intergenic
1087308740 11:96515356-96515378 GTGCCATTTACACACAGGAATGG - Intergenic
1089182130 11:116590375-116590397 GCTCCATTCTCACATAATGATGG + Intergenic
1090763000 11:129853596-129853618 GTACCATTTTCACCCAGTCAAGG - Intronic
1092509375 12:9138289-9138311 GTACCACATTCACAGAATAAAGG - Intergenic
1093677287 12:21958231-21958253 GTTCCAATTTCACAATATTAAGG - Intergenic
1094544152 12:31388725-31388747 GTGCCACTTTCAAAAAATAAAGG + Intronic
1095475633 12:42584694-42584716 TTTCCAATTACACACAATATTGG - Intronic
1096953060 12:55495599-55495621 GTTACTTTTTCACACCATATCGG - Intergenic
1098108853 12:67100567-67100589 GTTCCTATTTCACAGAATACAGG + Intergenic
1098202759 12:68074358-68074380 GTGCCCTTTTCACAGAATAATGG - Intergenic
1099367518 12:81786470-81786492 GCTGACTTTTCACACAATAAAGG - Intergenic
1099832481 12:87862193-87862215 TTGCCATTTTTACAAAATAAAGG + Intergenic
1102826680 12:115952801-115952823 GCTGAATTTTAACACAATAATGG + Intergenic
1104314918 12:127689072-127689094 TTTCCATTTGCACAAAATCACGG + Intergenic
1105591475 13:21796664-21796686 GTTGGATTTCCACACAAAAAAGG - Intergenic
1106575294 13:30968802-30968824 GGGTCATTTTCAAACAATAAGGG + Intronic
1106616761 13:31337484-31337506 GGTCCAGTTTCACATAAAAAAGG - Intergenic
1109820432 13:67645436-67645458 GTTCCATTTTAACATAAAAAGGG + Intergenic
1110231229 13:73169532-73169554 GTGCCATTTTCACAGACAAAAGG + Intergenic
1110576087 13:77056595-77056617 GTTCCAATTTCACTCTTTAATGG + Intronic
1111054573 13:82932007-82932029 GTTCTATGTTCTGACAATAAAGG + Intergenic
1113124653 13:106963393-106963415 GTTCAATTTTCTCAGAAGAATGG + Intergenic
1113165329 13:107434197-107434219 TTTGCATTTTAACACAATAATGG - Intronic
1117022148 14:51581977-51581999 CTTCCATTTTGAGACAAAAAGGG + Intronic
1117219845 14:53592226-53592248 TCTGCATTTTCACACAAAAATGG - Intergenic
1117487233 14:56210722-56210744 GTTGAAGTTTCCCACAATAATGG + Intronic
1117500578 14:56347230-56347252 GTGCCCTTTTCACAGTATAAGGG + Intergenic
1117952968 14:61101008-61101030 GTTCCTTTTTCACTGAAAAATGG - Intergenic
1118562142 14:67097450-67097472 GTTCTCTTTGCACACAATGATGG + Intronic
1120464715 14:84842035-84842057 GTTACATTTCCTCACAAGAATGG + Intergenic
1121649276 14:95545201-95545223 GATGCATTTTCTCATAATAAGGG + Intergenic
1121807559 14:96843814-96843836 CTTCCATTATCACAAAATAAAGG - Intronic
1124444108 15:29713817-29713839 GTTTCAATTTCACACTACAAAGG + Intronic
1129488387 15:75899836-75899858 GTTCCATTTACAGCCAATACAGG + Exonic
1130863488 15:87911511-87911533 GTTCCATTTTCACACAATAAGGG + Intronic
1131048613 15:89332413-89332435 GTTTCTTTTTCAAACAATGATGG - Intronic
1131429031 15:92371602-92371624 GTTAAAATATCACACAATAATGG - Intergenic
1131853153 15:96564249-96564271 TGTCCATTTTCCAACAATAACGG + Intergenic
1132634850 16:938764-938786 GGTCGGTTTTCACACAGTAATGG - Intronic
1134185390 16:12081022-12081044 CTTCCTTTTTCAAAAAATAAAGG - Intronic
1135530125 16:23245903-23245925 TTTCCATTTAAACACATTAATGG + Intergenic
1135714292 16:24748024-24748046 GTGCTATTTTGACACAAGAAGGG + Intronic
1135905019 16:26503788-26503810 GCTGCATTTTCACACAGTTATGG - Intergenic
1139069766 16:63365819-63365841 TTTCCATTTTTACAAAATAAAGG + Intergenic
1139280901 16:65769590-65769612 GTTCCATGTTCAAAAAATAGTGG - Intergenic
1139320474 16:66109939-66109961 GTACCCTTTTCTCCCAATAAAGG + Intergenic
1144238580 17:13287037-13287059 GCTCCATGTGCACACACTAATGG - Intergenic
1145725611 17:27120252-27120274 GTTGCATTTTCACTAAAAAAAGG + Intergenic
1149087233 17:52732735-52732757 TTTCCATTTTTCTACAATAAGGG - Intergenic
1149509151 17:57223914-57223936 TTTCCACTTTCACATAATAAAGG - Intergenic
1153722914 18:7925086-7925108 GTTCCATTTTCTAAAAACAATGG + Intronic
1154195412 18:12262392-12262414 GCTACATGTTTACACAATAAGGG - Intronic
1158484706 18:57855818-57855840 GCTTCATTTTCACAGAAAAAGGG + Intergenic
1160461933 18:79046127-79046149 GTTAATTTTTCACATAATAAGGG + Intergenic
1165298781 19:34953332-34953354 ATTCCATATTAACAGAATAAAGG + Intergenic
925936785 2:8771299-8771321 CTTTCATTTTCACATACTAAGGG + Intronic
927744677 2:25607011-25607033 TTTCCATTTTCTCACTAAAAAGG + Intronic
928565675 2:32545962-32545984 GTTCCATTTTCACATCTAAAAGG + Intronic
928791712 2:34964715-34964737 GGACCACTTTCACACTATAAGGG - Intergenic
929214174 2:39392953-39392975 ATTCCATTATAACAGAATAAAGG + Intronic
929369306 2:41202673-41202695 GGTCCATTTTTAAAAAATAATGG - Intergenic
930816146 2:55600130-55600152 GTTCTATTTTCTCATTATAAGGG + Intronic
931157376 2:59650630-59650652 TTTACCTTTTCACACAAAAAGGG - Intergenic
932965310 2:76467540-76467562 TTTCCATTTTCTCACATTATAGG - Intergenic
936508651 2:113128285-113128307 ATTCCATTTTCAAATCATAATGG - Intronic
939606440 2:144260986-144261008 GTTCCTTTTTCTCACTAGAAAGG - Intronic
942676116 2:178428332-178428354 GTTCCATTTTTTCCCAATCAGGG + Intergenic
1169580299 20:7015303-7015325 GCTCCTTTTTCAAACAATCATGG - Intergenic
1174853678 20:54022025-54022047 GCTGCATTTTTACACATTAAAGG - Intronic
1178208283 21:30496174-30496196 GTGGCATTTTCTCACAATACAGG - Intergenic
1179037541 21:37771948-37771970 GTTCCATATTCAGACAAGATGGG - Intronic
1179087083 21:38227487-38227509 CTACCATTTTCACACAGTCATGG + Intronic
1182819693 22:33204722-33204744 TTCCCATTTTCACACAGCAAAGG + Intronic
1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG + Intronic
1185126945 22:49016669-49016691 GCCCCATTTTCACACAAGAGGGG + Intergenic
949180474 3:1124217-1124239 GTTCCTTTGTCTCACAACAAAGG + Intronic
950696940 3:14708543-14708565 TTTCCATTTCCACAAAAAAAAGG + Intronic
950824638 3:15804938-15804960 GTAACATTTTAACACTATAATGG + Intronic
952089214 3:29864538-29864560 GTTCCATTTTAACTCCATAGAGG - Intronic
952983920 3:38760690-38760712 GATCCATTGCCACACAGTAAGGG + Exonic
957879549 3:86193503-86193525 GTTCTATTTGTACACATTAAGGG - Intergenic
962054246 3:131851954-131851976 GCTCCATTTTCACCCATGAATGG - Intronic
962459483 3:135596166-135596188 GTTCCATTTTTAAACATGAATGG - Intergenic
963234311 3:142941437-142941459 TTTCCATTTTCACAAGAGAAGGG - Intergenic
963411113 3:144929186-144929208 GTTCCATAATGACACAATTAAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
963873178 3:150442040-150442062 GTTGCATTTTCACATAAGAAAGG - Intronic
964964326 3:162472207-162472229 GTTCTATTTTCCCACAGTCATGG - Intergenic
965056675 3:163726267-163726289 TGTCCAATTTTACACAATAATGG + Intergenic
965901008 3:173641871-173641893 TTTCTATTTTCACACTACAATGG + Intronic
967407918 3:189138068-189138090 GTTCCATTATCACATAATAATGG + Intronic
967653047 3:192009993-192010015 ATTCCACTTACACACAATTATGG + Intergenic
970537170 4:17041679-17041701 GTTCCATTTTCAGAAAGCAAGGG + Intergenic
972371260 4:38425290-38425312 TTTCCCTTTTTACACAAAAAGGG + Intergenic
972854288 4:43087640-43087662 TTTCCATTTTCACATAGTAATGG - Intergenic
973944476 4:55943086-55943108 CTTCCATTTTCCAATAATAATGG + Intergenic
974894594 4:67924078-67924100 GTTCAATTTTCACATCAGAAAGG - Intronic
975998488 4:80343202-80343224 CTTAGAATTTCACACAATAATGG + Intronic
977061514 4:92263587-92263609 GATCAATTTTTAAACAATAAAGG + Intergenic
977820578 4:101467792-101467814 GTTGCAATTTCACAAAATACAGG - Intronic
980309775 4:131111411-131111433 ATACCATTTTCACTGAATAATGG - Intergenic
981350549 4:143724725-143724747 GTGCATTTTTCTCACAATAAAGG + Intergenic
983092401 4:163519967-163519989 TTTCCTTTTTTACAGAATAAGGG + Exonic
984901238 4:184588408-184588430 GTTTGATATTCATACAATAATGG + Intergenic
986930695 5:12816722-12816744 GCTCAATTTTCACATAATCACGG + Intergenic
987950495 5:24668900-24668922 CTTCCATATTCACACAAGGACGG - Intergenic
988546100 5:32158985-32159007 CTTCCAATTTCACAAGATAATGG + Intronic
989289349 5:39744807-39744829 ATTCCCTTTTTATACAATAAAGG + Intergenic
990262517 5:54039995-54040017 ATTCCAATTTCAAACAAGAAAGG + Intronic
992242025 5:74781656-74781678 GTGCCATTTTCACAGAATGCAGG - Exonic
992323603 5:75638313-75638335 GTTTCATTTGCACAAAATTAAGG + Intronic
994516638 5:100780722-100780744 GTACGATTTTCACACAAAAAGGG + Intergenic
994879956 5:105477889-105477911 TTTTCATTTTCACAGAATATAGG - Intergenic
995268776 5:110196132-110196154 TTTCCAGTTTCACTCAATTATGG - Intergenic
996309380 5:122086385-122086407 TTTTCATTTTCACACATTTATGG + Intergenic
998678962 5:144443137-144443159 GTTCCAGTTTCACGCAAGTAAGG - Intronic
999248895 5:150169894-150169916 GTTCCAGTTTCACACAAGCGGGG + Intronic
1000243337 5:159428792-159428814 GTTCTATTATCACACACTTATGG - Intergenic
1001275368 5:170346916-170346938 TTTCCATGATCACACAGTAAAGG + Intergenic
1003354761 6:5357201-5357223 GCTCCATTTTCTCCCCATAATGG - Intronic
1004022222 6:11786315-11786337 GTTTCATTTTGACACAAGAGAGG + Intronic
1004041899 6:11987602-11987624 CTTCCCTTTTCAGACAATATAGG + Intergenic
1005984995 6:30866178-30866200 GTTCCAGTTCATCACAATAAAGG + Intergenic
1008059603 6:46983727-46983749 GTGCCATTTTCAGAAAAAAATGG - Intergenic
1009617427 6:66028537-66028559 ATTTAATTTTCACAAAATAAAGG + Intergenic
1010355450 6:74927376-74927398 CTTCCATTTTTGCTCAATAAAGG - Intergenic
1010380794 6:75222698-75222720 ATCCCATTATCACACAAGAAGGG + Intergenic
1010660435 6:78564291-78564313 GTTCCATTTAAAAACAAGAAAGG - Intergenic
1011140869 6:84154827-84154849 ATTCCTGTTTCACAAAATAATGG + Intronic
1011708221 6:90024822-90024844 GGTCAACTTTCACACATTAATGG + Intronic
1013823370 6:114182247-114182269 GTTCCACATTTAGACAATAACGG + Intronic
1016606321 6:145932687-145932709 GTTAAATTTTGACACATTAAAGG - Intronic
1016861822 6:148727963-148727985 GTTTCCTTTTCCCTCAATAAGGG + Intergenic
1018078534 6:160238622-160238644 CTTTCTTTTCCACACAATAATGG - Intronic
1018995939 6:168710442-168710464 GTTCCATTTCCTCACAGGAACGG + Intergenic
1020294957 7:6751464-6751486 GTTTCATTTTAAAACAAAAAAGG - Intergenic
1020642509 7:10773536-10773558 ATTACATTTTCACACCATTAGGG - Intergenic
1020959531 7:14785859-14785881 GTACAATTTTCAGACATTAAAGG + Intronic
1021218523 7:17946817-17946839 GTTTCATTTTTACAGAAGAAGGG + Intergenic
1022245042 7:28551064-28551086 CTTCCATTTCCACAGAAAAAGGG + Intronic
1025706095 7:63865926-63865948 GTTCTATTTTTACACAGTACTGG - Intergenic
1027573045 7:79895886-79895908 GTTTCATTTTCACTCTAAAATGG + Intergenic
1030328523 7:108247946-108247968 GTTCCATTTAAAAACAAAAATGG + Intronic
1034327921 7:150254485-150254507 GTTCCTTTCTCAGAAAATAAAGG + Intronic
1034765289 7:153714953-153714975 GTTCCTTTCTCAGAAAATAAAGG - Intergenic
1040677477 8:49767605-49767627 GTTCCATTTTCCAATAAGAAAGG - Intergenic
1042938785 8:74087020-74087042 ATTCAATATTCACACAAGAAGGG - Intergenic
1043313459 8:78891368-78891390 ATTCCTTTTACTCACAATAATGG + Intergenic
1043865531 8:85370866-85370888 GATCCATTTAAACACAATAATGG - Intronic
1044149575 8:88758569-88758591 ATTCCAGATTCCCACAATAAAGG - Intergenic
1046420518 8:113977108-113977130 GTTCCAATTTCATACAATAAAGG + Intergenic
1048814948 8:138323791-138323813 TTTCCATTTTCAGAAAAAAAAGG - Intronic
1050106474 9:2171474-2171496 GTTTCATCTCCACACAAAAATGG - Intronic
1050428155 9:5533964-5533986 TTTCTATTTTCTGACAATAAAGG - Intronic
1050700269 9:8330441-8330463 GTTCCAGATTACCACAATAAAGG - Intronic
1050926221 9:11266930-11266952 TTTCCATTGACAAACAATAATGG + Intergenic
1057475248 9:95394534-95394556 GTTACATTTTCAAAAAGTAAGGG + Intergenic
1058191905 9:101927754-101927776 TTTCCATTTTCACACTCCAAGGG + Intergenic
1058298270 9:103336689-103336711 GCCCCATTTGTACACAATAATGG - Intergenic
1060065750 9:120499150-120499172 GTACCATTTTCACATTAAAAAGG - Intronic
1060830141 9:126708584-126708606 GTTCACTTTTTACAGAATAAAGG + Intergenic
1060878040 9:127097509-127097531 ATTTCCTTTTCACACATTAAAGG + Intronic
1062493534 9:136821174-136821196 GTGCCATTTTTACAAAATGAAGG + Intronic
1189251925 X:39606948-39606970 GTTACATCTTCACAGAATATTGG - Intergenic
1189764248 X:44353561-44353583 GTACCATATTAACAGAATAAAGG + Intergenic
1192595572 X:72404342-72404364 GTCCCCTTTTCAAACAATATGGG + Intronic
1193961268 X:87927381-87927403 CTTACATTTCCACACAATAATGG + Intergenic
1194913805 X:99680092-99680114 TTTCCACTTTGAGACAATAAAGG - Intergenic
1196246995 X:113412111-113412133 GTTCCATATCCCCAAAATAAAGG + Intergenic
1197450076 X:126601755-126601777 TTTATATTTTCACACAACAAAGG + Intergenic
1197538788 X:127727986-127728008 GAATCATTTTCACACAGTAAGGG - Intergenic
1197682155 X:129397061-129397083 TTTCCAGTTTCACACCATCATGG - Intergenic
1197747248 X:129939918-129939940 GTTCTATTTTCTCACAGGAAGGG + Intergenic
1199090282 X:143683367-143683389 TTTTCATTTGCACACAATTAGGG - Intergenic
1201481333 Y:14442641-14442663 TTTCCTTTTCCACACAATAAAGG + Intergenic