ID: 1130864637

View in Genome Browser
Species Human (GRCh38)
Location 15:87922030-87922052
Sequence TGGGAATCTCATTTAATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130864637_1130864642 8 Left 1130864637 15:87922030-87922052 CCACTTATTAAATGAGATTCCCA 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1130864642 15:87922061-87922083 ACGAAGAGCAGAAAGCATGGTGG 0: 1
1: 0
2: 0
3: 20
4: 255
1130864637_1130864641 5 Left 1130864637 15:87922030-87922052 CCACTTATTAAATGAGATTCCCA 0: 1
1: 0
2: 2
3: 15
4: 167
Right 1130864641 15:87922058-87922080 CCAACGAAGAGCAGAAAGCATGG 0: 1
1: 0
2: 2
3: 19
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130864637 Original CRISPR TGGGAATCTCATTTAATAAG TGG (reversed) Intronic
905488690 1:38326666-38326688 TGAGACTCTCATTTTATAAAGGG - Intergenic
908277748 1:62493271-62493293 TTCCAATCTCATTGAATAAGAGG - Intronic
909628649 1:77747849-77747871 TGGGGAGATTATTTAATAAGTGG - Intronic
914655393 1:149735399-149735421 TAGGGATTTCATTTAATATGAGG + Intergenic
915042274 1:152978708-152978730 AAGTAATCTCATTTAATAATAGG + Intergenic
916190529 1:162173307-162173329 AGGGAATCCTATTTAATAAATGG - Intronic
916523459 1:165587157-165587179 TGGGACTCTCTTTTTAAAAGGGG - Intergenic
917119157 1:171630755-171630777 TGGGCATCTCATCTAATATCAGG - Intergenic
918556113 1:185801344-185801366 TGGATATCTCATGAAATAAGTGG - Intronic
921637033 1:217508154-217508176 TGGGAATCACAATAAATCAGAGG + Intronic
923603768 1:235425225-235425247 TGGAACTGTCATTTATTAAGAGG - Intronic
924287967 1:242507888-242507910 TGGTAATTACATTTAATAAATGG + Intronic
1065371694 10:24993400-24993422 TGGAAATCACAGTTACTAAGTGG + Intronic
1066638664 10:37533542-37533564 TGGGAACCAGATTTAAAAAGGGG + Intergenic
1067443094 10:46323011-46323033 TGGGATCCTCATTAAATAAACGG - Intronic
1071233035 10:83611396-83611418 TGTGAATGTCATATAATAAGAGG - Intergenic
1071265560 10:83961596-83961618 TTGAAACCTCATTTAATAAAAGG - Intergenic
1075303740 10:121348977-121348999 TGAGAATATCATTTTATTAGAGG - Intergenic
1076210475 10:128639062-128639084 TGCAATTCTGATTTAATAAGAGG + Intergenic
1077455582 11:2677099-2677121 AGGGAAACTAATTTCATAAGTGG - Intronic
1078726876 11:13939872-13939894 TGGGAATTCCATTTAAGAAGGGG + Intergenic
1079492083 11:21000453-21000475 TGGGAATCTGATTTCGTCAGAGG - Intronic
1081562646 11:44232104-44232126 TGGGAATTTCAATTAATGTGGGG - Intronic
1081820856 11:45993347-45993369 TGAGAGTCTTATTTGATAAGAGG - Intronic
1084093291 11:66893593-66893615 TGAGAATCTCATTTAACAACTGG + Intronic
1086761549 11:90637424-90637446 AAGGATTCCCATTTAATAAGTGG - Intergenic
1087401903 11:97677893-97677915 TGTGAATCTCATTTATTTAGTGG + Intergenic
1088113408 11:106288194-106288216 TGAGAATGTCATAAAATAAGTGG + Intergenic
1092778446 12:11964112-11964134 TGGGAATCTCATTTGACCTGTGG + Intergenic
1093045114 12:14434218-14434240 TGGGACTCTGATTTCATAAAAGG + Intronic
1094387242 12:29908549-29908571 AGGGTATCACATTTAATAAGAGG + Intergenic
1095546101 12:43372138-43372160 TGGGACTGTCATTTAATAGATGG + Intronic
1100832980 12:98535828-98535850 TTGGAATCTAAATTTATAAGAGG + Intronic
1101053390 12:100887265-100887287 TGGTGATCTCATTTAATAAGTGG + Intronic
1103208398 12:119148648-119148670 TGAGAAACTCAGTTAATAAGTGG + Intronic
1104279280 12:127359418-127359440 TGGGAATTTCATTTAAAATGTGG + Intergenic
1104279463 12:127361241-127361263 TGGGAACGTCATTTAAAATGTGG - Intergenic
1106416087 13:29547188-29547210 GGGGTATCACATTTAAGAAGAGG - Intronic
1106443314 13:29800458-29800480 ATGGAATCTCAGTTAAAAAGAGG - Intronic
1108433997 13:50383623-50383645 TGAAAATCTAATTTAATAAAAGG - Intronic
1108789840 13:53955574-53955596 AGGTGATCTTATTTAATAAGTGG + Intergenic
1109778890 13:67081193-67081215 TGGCAATCACATATAATAAATGG + Intronic
1109898647 13:68731481-68731503 TGGGAATCTTAGCTGATAAGTGG - Intergenic
1113062979 13:106343888-106343910 CTGTAATCTCATTTGATAAGGGG - Intergenic
1113135375 13:107083234-107083256 TGGTATTCTTATTTAATAAGGGG - Intergenic
1116635833 14:47394059-47394081 TGGCATTTTCATTTCATAAGGGG - Intronic
1117405348 14:55396818-55396840 TGGGAATCTGAGTTATTAACAGG - Intronic
1119922553 14:78459844-78459866 TCAGAATCTGATTTAATTAGAGG - Intronic
1121749486 14:96337830-96337852 TGGGAATTGCATTGAATATGTGG + Intronic
1121835987 14:97092855-97092877 TTGGAATCTGATCCAATAAGTGG - Intergenic
1126931440 15:53656594-53656616 TGGTACTCTCAGTCAATAAGTGG + Intronic
1127086708 15:55430897-55430919 TGGGAATCTAATTTAAAACTTGG - Intronic
1127567996 15:60212401-60212423 TGAGAAGCTCATATAATAATTGG - Intergenic
1127728237 15:61772241-61772263 TAGGAATCTCAGTAAATAAATGG + Intergenic
1130864637 15:87922030-87922052 TGGGAATCTCATTTAATAAGTGG - Intronic
1131645480 15:94337446-94337468 TGGCAATTTCATTTAATTAAAGG + Intronic
1132303497 15:100790799-100790821 TAGGAAGTTCATTTTATAAGGGG - Intergenic
1140054453 16:71513523-71513545 TGGGAAACTCCTTTCAGAAGAGG - Intronic
1140662387 16:77199838-77199860 TGGGAATTACTGTTAATAAGGGG - Exonic
1141870405 16:86781453-86781475 TGGGAATGGCACTTCATAAGAGG + Intergenic
1147664493 17:42137993-42138015 TGGGAATCTTATTTTTTATGAGG - Intronic
1151637449 17:75360736-75360758 TAGGACTCTTATTTTATAAGGGG - Intronic
1152031102 17:77843626-77843648 TGGGAATCTGATCAAAAAAGGGG + Intergenic
1154051842 18:10967771-10967793 AAAGAATCTCATTTAAAAAGTGG - Intronic
1155095435 18:22550710-22550732 TGGGTATCTCATTTCATAGAAGG + Intergenic
1157206922 18:45708586-45708608 TGGGAAATTCATTGATTAAGTGG - Intergenic
1158131889 18:54161285-54161307 TTGAAAATTCATTTAATAAGTGG - Intronic
1158758459 18:60355249-60355271 TTAGAATCTCATTGAATAAAAGG + Intergenic
1162632929 19:11942918-11942940 TGAGAATCTCACTTATTAATGGG + Intronic
1164409635 19:27990082-27990104 TGGGAATCTAAATTTTTAAGAGG + Intergenic
1167061243 19:47148085-47148107 TGGGAATCCCATATAAAACGAGG - Intronic
926924588 2:17974470-17974492 AGGCAATCTCCTTTAATAAAAGG + Intronic
927344453 2:22021434-22021456 TGAGACTCTAATTTAATAGGAGG - Intergenic
929547461 2:42864866-42864888 TGATAAACTCATTTACTAAGAGG + Intergenic
930398227 2:50849165-50849187 TCGGAATTTAATTTTATAAGTGG + Intronic
932326394 2:70864785-70864807 TGGGAATCTCACTTGATTTGGGG - Intergenic
935733220 2:106083771-106083793 TGGAAATCCCTTTAAATAAGGGG - Intergenic
936269544 2:111038380-111038402 TGGGAAACACATTTAAAAAGTGG - Intronic
937152922 2:119698234-119698256 TAGGAATCTCATCAAATAAGCGG - Intergenic
938202635 2:129387780-129387802 TGGGACTCTCATTTAGTTACTGG + Intergenic
939318803 2:140588567-140588589 TGGCAAACTCATTAAATAAATGG + Intronic
939531072 2:143362447-143362469 TGGGAATCTCCACAAATAAGAGG - Intronic
940587680 2:155674733-155674755 AGGGCATCTTATTCAATAAGTGG + Intergenic
941151068 2:161916252-161916274 TGGGATTGTCATTTACTGAGGGG - Intronic
941492482 2:166159549-166159571 TGGGAAGCTCAATCAATCAGTGG - Intergenic
942497844 2:176558453-176558475 TGGGAATTTTCTTTATTAAGAGG + Intergenic
943797795 2:192018753-192018775 TGAGAATCTCATGTATTAACTGG + Intronic
944183110 2:196917578-196917600 TGGATATCTCATATAATACGTGG + Intronic
944911817 2:204317896-204317918 TGGGAAGCTGAGTTGATAAGTGG - Intergenic
946616630 2:221517184-221517206 AGGGGATCTCAATTAATAAAGGG + Intronic
947025115 2:225729264-225729286 TGAGAATCTGATTTGATATGTGG + Intergenic
947684612 2:232071871-232071893 TGGGAATGTTTTTGAATAAGAGG + Intronic
1170275544 20:14582840-14582862 TGAGATACTCATATAATAAGAGG + Intronic
1170367410 20:15612981-15613003 AGAGACTGTCATTTAATAAGTGG + Intronic
1173425436 20:42939134-42939156 GGGAAAACTCATTTAATAAGAGG - Intronic
1174214016 20:48902267-48902289 TGGGCATTTCATGTAATATGTGG + Intergenic
1176456839 21:6920330-6920352 CAGGAATCTCATAGAATAAGAGG - Intergenic
1176835012 21:13785390-13785412 CAGGAATCTCATAGAATAAGAGG - Intergenic
1178825544 21:36013435-36013457 TGGGTATTTCATATAATAAAGGG - Intergenic
1182526128 22:30921344-30921366 TAAGAGGCTCATTTAATAAGTGG + Intergenic
949436047 3:4030492-4030514 TTGGAATCTCATCTTATAGGAGG + Intronic
949495932 3:4632152-4632174 TGGGAATCTAGTTGAATAGGTGG + Intronic
952435852 3:33271812-33271834 TTGGAAACTCATTAAACAAGTGG - Intergenic
952860652 3:37809763-37809785 TGGGAATCAGAGTTAACAAGAGG - Intronic
955695908 3:61636392-61636414 TGGACATTTCATTTAATAGGTGG + Intronic
957646469 3:82937313-82937335 TGAGTATCACATTTAATAAATGG - Intergenic
959384984 3:105692897-105692919 TGGGTATCTCATTTGAAAAATGG - Intronic
960038434 3:113125120-113125142 GCTTAATCTCATTTAATAAGTGG + Intergenic
962428776 3:135300166-135300188 TGGTATTCTCATTTTAAAAGTGG - Intergenic
963843482 3:150131444-150131466 TTGGAATCTAGTTTTATAAGTGG + Intergenic
964038037 3:152222722-152222744 TGGGAATCTCATTGAACTGGGGG - Intergenic
964987176 3:162758051-162758073 TGGGAAACTATTTTAATAATTGG - Intergenic
965612263 3:170556958-170556980 TGGGAGTCTCATTTAAAAAGTGG + Intronic
966304589 3:178516628-178516650 TGTCAATCTTATTTTATAAGTGG + Intronic
966670291 3:182518680-182518702 CTGGAAGCTCATTTAAAAAGTGG + Intergenic
970898717 4:21133638-21133660 TAGGAATGGCATTTACTAAGTGG - Intronic
971399805 4:26265606-26265628 TAGGAATCTCATCAAATAATCGG - Intronic
976074978 4:81287628-81287650 TAGGAACTTCTTTTAATAAGAGG + Intergenic
978431955 4:108641957-108641979 TGTGGATCTGAATTAATAAGTGG + Intergenic
979336346 4:119467697-119467719 TGGTTATCCCATTGAATAAGTGG - Intergenic
980516753 4:133872805-133872827 TGGAAATATCATTTAAAAATAGG + Intergenic
981048689 4:140290352-140290374 TGGGACACTCATTTGACAAGAGG + Intronic
981252160 4:142616260-142616282 TAGGAATCTCATCAAATAACTGG - Intronic
983153663 4:164317530-164317552 AGGGAATCTCTTTTGAAAAGGGG - Intronic
983184363 4:164684453-164684475 TTGAATGCTCATTTAATAAGGGG - Intergenic
983239253 4:165213038-165213060 TGGTTATCCCATTGAATAAGTGG - Intronic
984988983 4:185359671-185359693 TGGGAATTTCTTTTAATTACAGG - Intronic
985024120 4:185722390-185722412 TGGGCATTTAATTTAAAAAGTGG + Intronic
987651710 5:20749639-20749661 GGGCAATTACATTTAATAAGGGG - Intergenic
988743852 5:34111840-34111862 GGGCAATTACATTTAATAAGGGG + Intronic
989289994 5:39752855-39752877 TGGCAATGTGATTTAACAAGCGG + Intergenic
990670280 5:58121342-58121364 TGGGAGTATCATATACTAAGGGG + Intergenic
991141328 5:63247352-63247374 TAGGAATCTCATCAAATAATCGG + Intergenic
991562918 5:67973284-67973306 TGGGAATATCACTTGCTAAGTGG - Intergenic
992014956 5:72566322-72566344 TGAGAAACTCTTTTAAGAAGAGG - Intergenic
993289542 5:86047645-86047667 TGGTAATCTCTTTTATTAAATGG + Intergenic
995176733 5:109186645-109186667 TGGGAATATTATTTAAAAGGAGG - Intronic
997466141 5:134089409-134089431 TGGGAACCACATTGGATAAGGGG - Intergenic
997876151 5:137549273-137549295 AGGGAATCCTATTTAATAAATGG + Intronic
1002033395 5:176447477-176447499 GGGGAATCTCATTCAACAAATGG + Intergenic
1012425768 6:99112916-99112938 TGGGGATATAATTTTATAAGTGG + Intergenic
1012804270 6:103875407-103875429 TAGGAATCTCATAAAATAACTGG + Intergenic
1015368652 6:132425630-132425652 TGGGAGCCTCATGGAATAAGGGG - Intergenic
1017964003 6:159247797-159247819 TGGGAGAGTCATTCAATAAGTGG + Intronic
1020442993 7:8238920-8238942 TGGGAATCTAGTTTTATAATAGG + Intronic
1020464023 7:8456044-8456066 TGGGTAAGTCATTTGATAAGTGG + Intronic
1020647781 7:10836199-10836221 TGGCAATATCAATAAATAAGTGG + Intergenic
1020837741 7:13175155-13175177 TGTTAATCCCACTTAATAAGTGG + Intergenic
1021024740 7:15650865-15650887 TGGGAGTCCCTTTTAATAAAAGG - Intronic
1021529341 7:21626168-21626190 TGGGAATTTTTTTTAAAAAGCGG - Intronic
1024687024 7:51757233-51757255 TGGGAATTTTGTTAAATAAGTGG - Intergenic
1026137280 7:67674476-67674498 TGGGAATCCCTCCTAATAAGTGG + Intergenic
1027441621 7:78225193-78225215 TTGGAATCTCAGAAAATAAGGGG - Intronic
1027650484 7:80861477-80861499 TCTAAATCACATTTAATAAGAGG + Intronic
1027707004 7:81548229-81548251 TTGGAACCTCATAAAATAAGAGG - Intergenic
1027803030 7:82780224-82780246 TGAATGTCTCATTTAATAAGAGG - Intronic
1028476503 7:91259263-91259285 TGAAAATCTCTTTTGATAAGTGG + Intergenic
1031405723 7:121384368-121384390 TGGGGTTTTCATTTAAAAAGCGG - Intronic
1033582110 7:142747718-142747740 TGGGAATTTCATCTAAGAGGAGG - Intergenic
1033593331 7:142833591-142833613 TGAGAATCTCATTAAAGGAGTGG + Intergenic
1034232405 7:149541499-149541521 TTAGAATCTCTGTTAATAAGGGG - Intergenic
1034549970 7:151814256-151814278 GGGGTATCTGATTTAATAAGAGG + Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037781970 8:21875702-21875724 AGGTGATATCATTTAATAAGAGG - Intergenic
1039102734 8:33958094-33958116 GGGGATTCACATTTAAAAAGTGG + Intergenic
1039318919 8:36406681-36406703 TGGAAATGTGATTTAAGAAGAGG + Intergenic
1041435613 8:57837749-57837771 TGGGATAGTCATTAAATAAGTGG - Intergenic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1043147326 8:76674496-76674518 TGGGAATCACCTTTAAGAATAGG + Intergenic
1043561913 8:81502962-81502984 TGGGAATCTCATTTGGAAAATGG - Intergenic
1043629992 8:82318853-82318875 TGGGTATCTCATTTCATAAATGG - Intergenic
1043751286 8:83938813-83938835 TGGGAAAATAATTAAATAAGTGG - Intergenic
1046970340 8:120215925-120215947 TGGGCATCTCATTTTACATGTGG + Intronic
1048230850 8:132639683-132639705 TTGGGATCTGACTTAATAAGAGG - Intronic
1049023669 8:139974158-139974180 GGGGAATCTGAGATAATAAGAGG + Intronic
1052150579 9:25110006-25110028 AGGAAATCTCATATAATAAAAGG - Intergenic
1059370295 9:113825384-113825406 AGGGCATCTCATTTACTACGAGG - Intergenic
1060282249 9:122222428-122222450 TGGGAATCTCAGGGAGTAAGGGG + Intronic
1060346488 9:122821133-122821155 TTGGAACCTCATTTATAAAGTGG - Intronic
1061544689 9:131297907-131297929 TGGAAATCCTATTTTATAAGTGG + Intronic
1185910394 X:3975694-3975716 TGAGAATCTCACTTAATAGTGGG - Intergenic
1191639628 X:63416200-63416222 TGGGACTCTCACTTAATAATGGG - Intergenic
1197192675 X:123665532-123665554 TATGAACCTCATTTAATAAAGGG - Intronic
1198391878 X:136183656-136183678 TGGAAATATCATTTAATTAAGGG - Intronic
1202599830 Y:26581916-26581938 TGGTAATCTCATTTCAAAAAGGG - Intergenic