ID: 1130867520

View in Genome Browser
Species Human (GRCh38)
Location 15:87945238-87945260
Sequence CTGTCTCACAAAAAGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 689
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 631}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130867520_1130867525 1 Left 1130867520 15:87945238-87945260 CCTAATTCCTTTTTGTGAGACAG 0: 1
1: 0
2: 3
3: 54
4: 631
Right 1130867525 15:87945262-87945284 CACCAACTGGGTTCCACCAGAGG 0: 1
1: 0
2: 1
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130867520 Original CRISPR CTGTCTCACAAAAAGGAATT AGG (reversed) Intronic
900170595 1:1266519-1266541 CTGTCTCAAAAAAATAAATAAGG + Intronic
900248095 1:1648774-1648796 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900259314 1:1715931-1715953 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900665030 1:3809387-3809409 CTGTCTCAAAAAAAAAAAGTGGG - Intergenic
901106569 1:6760906-6760928 CTGTCTCAAGAAAAGGAAAAAGG + Intergenic
901314425 1:8296348-8296370 ATATCACACAAAAAAGAATTCGG + Intergenic
901652169 1:10749250-10749272 CTGTCTCAAAAAAAAAAAATAGG - Intronic
901832812 1:11903771-11903793 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
902239019 1:15075951-15075973 CTGTCCCAGGGAAAGGAATTAGG - Intronic
902562345 1:17285475-17285497 CTGTCTCAAAAAAAAGGATAGGG + Intergenic
902832299 1:19024269-19024291 GTATATCACAAAAAGGAATATGG + Intergenic
903396546 1:23006004-23006026 CTGTCTCAAAAAAAGGGAGTTGG + Intergenic
903487477 1:23701438-23701460 CTGTCTCAAAAAAATAAAATAGG + Intergenic
903537856 1:24079202-24079224 CTGTCTCAAAAAAAAGAATGAGG - Intronic
903592132 1:24464683-24464705 CTGTCTAGCCTAAAGGAATTCGG + Intronic
904086466 1:27912952-27912974 CTGTCTCAAAAAAAGAAATGTGG - Intronic
904186405 1:28708463-28708485 CTGTCTCAAAAAAACAAAATTGG - Intronic
904406659 1:30294982-30295004 CTGTAACAGAAAAAGGAAATAGG + Intergenic
904485328 1:30821106-30821128 CTGTTTCAAAAAAAGAAATGAGG - Intergenic
904513433 1:31033664-31033686 CTGTCTCAAAAAAATAAAATGGG - Intronic
904749892 1:32735137-32735159 CTGTCTCAAAAAAATGTTTTTGG - Intergenic
905172685 1:36118468-36118490 CTGTCTTACAAATAGGAAGCTGG + Intronic
905871570 1:41407356-41407378 TTGTCTCACAGAAAGGAACAAGG + Intergenic
906853754 1:49282359-49282381 TTGTCTCAAAAAAAGGAGTAGGG + Intronic
907228720 1:52975051-52975073 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
907636789 1:56143151-56143173 CTGTCTCAAAAAAAGAATTGTGG - Intergenic
908005953 1:59729804-59729826 CTGTCTCACCTAAAGGAGTAGGG - Intronic
908268693 1:62402521-62402543 CTGTCTCAAAAAAAAAAAGTGGG + Intergenic
909147455 1:71954704-71954726 CTGACTTCCAAAAAGGAAATTGG + Intronic
909387489 1:75075847-75075869 CTGTCTGACAAAATGAAGTTAGG - Intergenic
909580307 1:77225507-77225529 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
909654838 1:78020149-78020171 CTGTCTCAAAAAAAGGAAGCTGG + Intronic
910404930 1:86877948-86877970 CTGTCTCTCAGAAAGTAATGTGG - Intronic
910418497 1:87028408-87028430 CTGTCTTAAAAAAAATAATTTGG + Intronic
912326015 1:108763577-108763599 CTGTCTCAAAAAAAAAAGTTGGG - Intronic
912534752 1:110358328-110358350 CTGTCTCAATAAAAAGTATTGGG + Intergenic
914787270 1:150845601-150845623 CTGTCTCAAAAAAATAAAATAGG + Intronic
915323313 1:155067923-155067945 CTGTCTCTTAAAAAAGAAGTGGG - Intronic
915777867 1:158510887-158510909 CTGTCTCAAAAAAAGAAAAATGG - Intergenic
915949261 1:160177210-160177232 CTGTCTCAAAAGAAAAAATTGGG + Intronic
916539820 1:165742265-165742287 CTGTCTCAAAAAAAGAAAAGGGG - Intronic
916941417 1:169682551-169682573 CTTTCTCCTAAAAAGGGATTTGG + Intronic
917038734 1:170778641-170778663 CTGTCTTAAAAATAGGCATTAGG + Intergenic
918457805 1:184742394-184742416 CCGTTTCAAAAAAAGTAATTAGG - Intronic
918502939 1:185218308-185218330 CTGTCTCCCAAAAAAAAATCTGG - Intronic
918607417 1:186445047-186445069 CTATCTTAGAAAATGGAATTTGG - Intronic
918767132 1:188500541-188500563 CGGTCTCACACAGAGGAAGTAGG - Intergenic
919484464 1:198129878-198129900 CTGTCTCAGCAAGAGGAATGAGG + Intergenic
919636755 1:200010881-200010903 CTGTCTCAAAAAAAGAATTGAGG - Intergenic
920007248 1:202842424-202842446 CTGTCTCAAGAAAAAGACTTAGG - Intergenic
920124886 1:203686294-203686316 CTGTCTCACAAACAGGAACTCGG + Intronic
920237528 1:204518149-204518171 CTGTCTCAAAAAAAGAGATGAGG + Intronic
920445966 1:206017492-206017514 CTGTCTCAAAAAAAATCATTTGG - Intronic
921387069 1:214580199-214580221 CTGTCTCAAAAAAAAAAAGTAGG - Intergenic
921489781 1:215760984-215761006 ATGGGTCACAAAAAGAAATTGGG - Intronic
922298959 1:224278735-224278757 CTGTCTCAAAAAAAAAAAATTGG - Intronic
922338530 1:224637318-224637340 CTGTCTCACAACTCTGAATTAGG - Intronic
922723674 1:227912273-227912295 CTGTCTCAAAAAAGGGAAGAAGG - Intergenic
923685761 1:236152454-236152476 CTGTCTCAAAAAAATGTATTGGG + Intronic
923737462 1:236624277-236624299 CTGTCTCCGAAAAAGGAAATAGG + Intergenic
924589426 1:245389115-245389137 CTGTCTCAAAAAAAAGAAAATGG - Intronic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924742552 1:246803752-246803774 CTGTCTCAAAAAAATAAATGAGG + Intergenic
1062785682 10:262853-262875 CTGTCTCAGGACAAGGGATTTGG - Intergenic
1062813681 10:483819-483841 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1062995755 10:1864960-1864982 CTGTCTCAAAAAAAAAAATGGGG + Intergenic
1063315475 10:5000392-5000414 CTGTTCCATAGAAAGGAATTAGG + Intronic
1063577220 10:7272795-7272817 CTGTCTCAAAAAAATGAAAGAGG - Intronic
1064019911 10:11800664-11800686 CTGTCTCAAAAAAAAAAAATAGG - Intergenic
1064134526 10:12739230-12739252 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
1064215258 10:13394878-13394900 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1064281708 10:13957255-13957277 CTGTCTCACAAAAAACAAAAAGG - Intronic
1064471648 10:15641567-15641589 CTGTCTCTCAAATAGGAATATGG - Intronic
1064971679 10:21072984-21073006 CTGTCTCAGAAAAAGAAAAAGGG + Intronic
1065683596 10:28262143-28262165 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1065957700 10:30707507-30707529 CTGTCTCAAAAAAAATAAATAGG - Intergenic
1066211112 10:33239281-33239303 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1066223247 10:33356555-33356577 CTATGTAAGAAAAAGGAATTAGG - Intergenic
1066372580 10:34829792-34829814 CTGTCTCAAAAAAACAAAATAGG + Intergenic
1067839279 10:49663223-49663245 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1068672858 10:59741682-59741704 CTGTTTCAAAATAAGGAAATAGG - Intergenic
1068725632 10:60299330-60299352 CAGTGTTACAAAAAGCAATTTGG - Intronic
1068868883 10:61922596-61922618 CCGTCTCAAAAAAAGAAAATAGG + Intronic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1071790951 10:88953370-88953392 ATGTCTTACAAAGAGGAATTTGG + Intronic
1072937569 10:99728089-99728111 CTTTTTTACCAAAAGGAATTAGG + Intronic
1074237149 10:111597013-111597035 GTGTCCCACTAAAAGGAACTAGG - Intergenic
1074510633 10:114108919-114108941 CTGTCTCAAAAAAAAAAATAAGG - Intergenic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1075536889 10:123278870-123278892 CTGTCTCACAAAAAAAAAGGGGG - Intergenic
1077866722 11:6228344-6228366 CTGTCTCAAAAAAAAAAATAGGG + Intronic
1078179271 11:8997071-8997093 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1078469753 11:11577510-11577532 CTCTCTAACAAAACGGAAATTGG - Intronic
1078491490 11:11773269-11773291 CGGTTTCAGGAAAAGGAATTTGG - Intergenic
1081212936 11:40358275-40358297 CTGTCTCAAAAAAAGGAGTTTGG - Intronic
1081495777 11:43608931-43608953 CTGTCTCAAAAAAAGAGGTTGGG - Intronic
1081530285 11:43953919-43953941 ATCTCTCACAAGAAAGAATTTGG - Intergenic
1081896253 11:46589622-46589644 CTGTCTCAAAAAAAAAAAGTTGG - Intronic
1081904120 11:46655740-46655762 CTGTCTCAAAAAAAGAAATGAGG - Intronic
1082045648 11:47724230-47724252 CTGTCTCAAAAAAAGGAGGTGGG - Intronic
1082062266 11:47871169-47871191 CTGTCTCAAAAAAAAAAAGTGGG - Intergenic
1082092642 11:48102410-48102432 CTGTCTCAAAAAAAAAAATTAGG - Intronic
1082186324 11:49186146-49186168 CTGTAGAACAAATAGGAATTTGG - Intronic
1083408338 11:62473993-62474015 CTGTCTCAAAAAAAAAAAATAGG + Intronic
1084920350 11:72464508-72464530 CTGTCTCAAAAAGAAGAATAAGG - Intergenic
1085033187 11:73285073-73285095 CTGTCTCAAAAAAGGGACGTAGG - Intronic
1085257746 11:75185637-75185659 CTCTCACACAAGAAAGAATTCGG + Intronic
1085658400 11:78338925-78338947 CTGTCTCAAAAAAAAAAATGTGG - Intronic
1085949982 11:81318780-81318802 CTGTCTGACAAAGGGGACTTTGG - Intergenic
1085980011 11:81713347-81713369 TCTTATCACAAAAAGGAATTTGG - Intergenic
1086208761 11:84293049-84293071 CTCTGTCACACTAAGGAATTTGG + Intronic
1086680009 11:89659225-89659247 CTGTAGAACAAATAGGAATTTGG + Intergenic
1087648569 11:100837426-100837448 CTTTGTCACACAAAAGAATTTGG + Intronic
1087659313 11:100967717-100967739 CTGTCTCAAAAAAAAGAAAAGGG - Intronic
1087900848 11:103638668-103638690 TTTTCTCCCTAAAAGGAATTAGG + Intergenic
1088190760 11:107226005-107226027 CTGTCTCAAAAAAAGAAAAGAGG - Intergenic
1088255016 11:107895410-107895432 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1090685356 11:129111762-129111784 CTGTCTCAAAAAAAGAAAGGGGG - Intronic
1090939794 11:131377124-131377146 CTGTCTCAAAACAAGGATTGAGG - Intronic
1090942220 11:131396827-131396849 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1091410305 12:234864-234886 ACCTCTCACAAGAAGGAATTTGG - Intronic
1091545255 12:1497461-1497483 CTGTCTCAAAAAAAATAAATAGG + Intergenic
1092460260 12:8680160-8680182 CTGTCTCAAAAAAAAAAATAAGG - Intergenic
1092491280 12:8947977-8947999 CTGACTCACTAAAAAGAAATAGG + Intronic
1092493422 12:8967722-8967744 TTGTCTCAAAAAAAGAAATGAGG + Intronic
1092496272 12:8998322-8998344 CTGTCTCAAAAAAAAAAATTCGG + Intronic
1092698654 12:11202233-11202255 TTGTCTCACAACCAGGAAGTAGG - Intergenic
1092811842 12:12278227-12278249 CTGTCTCAAAAAAAAAATTTAGG - Intergenic
1094232224 12:28119834-28119856 CTGTCTCAAAAAAAAAAATAGGG - Intergenic
1094549967 12:31441486-31441508 CTGTCTCAAAAAAAAAACTTGGG - Intronic
1094614062 12:32020631-32020653 CTCTCGCACAAGAAAGAATTCGG + Intergenic
1094643395 12:32298176-32298198 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1095044388 12:37484880-37484902 CTGTCTCAAAAAAAAGAAAATGG - Intergenic
1095463148 12:42463128-42463150 CTGTCTCACAAAAATTAGCTGGG + Intronic
1095729956 12:45495460-45495482 CAGTCTGACACAAAGGATTTTGG + Intergenic
1096639530 12:52982984-52983006 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1096643695 12:53015674-53015696 CTGTCTCAAAAAAAAAAAATGGG + Intronic
1096829869 12:54305648-54305670 CTGTCTCACAAAAACAAAATAGG + Intronic
1097092071 12:56514423-56514445 CTGTCTCAAAAAAAGAAAATAGG + Intergenic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1097612482 12:61841289-61841311 CTGCCTCAAAATAAGGTATTTGG + Intronic
1097692540 12:62746954-62746976 CTGTCTCAAAAAAAGAAAAAAGG - Intronic
1097762374 12:63482539-63482561 CTGTCTCAAAAAAAAAAGTTGGG - Intergenic
1098121532 12:67245570-67245592 CTGTCTCGAAAAAAAAAATTGGG + Intergenic
1098652434 12:72990184-72990206 CTGTCTCACCAAAGGGAGTTGGG - Intergenic
1098652585 12:72991664-72991686 CTGTCTCACCAAAAGGATTTGGG - Intergenic
1098704919 12:73675015-73675037 TGGCCTCACAAAAATGAATTTGG - Intergenic
1098979165 12:76936487-76936509 ATGTCTCAGAAAAAAAAATTAGG + Intergenic
1099847141 12:88042053-88042075 CTGTCTCACAGTAAGGAGTATGG + Intronic
1100272920 12:93043540-93043562 CTGTCTCAAAAAAAGGAAGGAGG - Intergenic
1100285556 12:93162933-93162955 CTGTCTCACAAAAATTAACCAGG + Intergenic
1100310477 12:93390609-93390631 CTGTCTCAAAAAAAGGGAGGGGG - Intronic
1100349421 12:93764802-93764824 ATGTATCACAAAAAAAAATTAGG - Intronic
1100497497 12:95139433-95139455 CTGTCTCAAAAAAAAAAAATCGG + Intronic
1100939766 12:99713396-99713418 CTGTTAAACAAAAAGGAACTAGG - Intronic
1101806785 12:108071034-108071056 CTGTCTCAAAAAAAAAAATGTGG - Intergenic
1101811074 12:108108397-108108419 CTGTCTCAAAAAAAAAAATGTGG - Intergenic
1101931762 12:109020697-109020719 CTGTTTCAGAGGAAGGAATTAGG - Intronic
1102064078 12:109958244-109958266 CTGTCTCAAAAAAAAAAATTGGG - Intronic
1102071874 12:110026875-110026897 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1102115857 12:110402738-110402760 CTGTCTCAAAAAAAGGAAACGGG - Intronic
1102235027 12:111289116-111289138 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1102717212 12:114984595-114984617 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1102900038 12:116629346-116629368 CTGTCTCATAGAAAGGAAGGAGG + Intergenic
1103235752 12:119371124-119371146 CTGTCTCAAGAAATGGAATCAGG - Intronic
1103638766 12:122331317-122331339 CCGTCTCAAAAAAATGAATAAGG - Intronic
1103660853 12:122515409-122515431 CTGTCTCTTAAAAAGGGATGAGG - Intronic
1103685981 12:122732199-122732221 CTGTCTCAAAAAAAAAAAATGGG + Intergenic
1105374797 13:19833978-19834000 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1105374888 13:19834693-19834715 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1105586475 13:21749147-21749169 CTGCCTCCCAAACAGAAATTAGG - Intergenic
1106635194 13:31521619-31521641 CTGTCTTAGCAAAAGGAATCAGG - Intergenic
1107068002 13:36237597-36237619 CTCTGTCACAGAAAGGAATAAGG + Intronic
1107158024 13:37192537-37192559 CTGTCTCCCTAAAAAGAGTTTGG + Intergenic
1107347806 13:39481669-39481691 CTGTAACACAAAAAGGAAGGGGG + Intronic
1107781158 13:43903754-43903776 CTGCCCCCCAAAAAGGAATATGG + Intergenic
1109845157 13:67979032-67979054 CTGTGTCAAAACAAGGATTTTGG - Intergenic
1109924161 13:69112479-69112501 CATTCTCACAAATAAGAATTTGG - Intergenic
1110567444 13:76970498-76970520 CTGTCTCAAAAAAAGGAGGTGGG + Intergenic
1111308043 13:86442072-86442094 CTGCCTCACATAAATTAATTTGG + Intergenic
1112018396 13:95350228-95350250 CTGTCTCAAAAAAAATAAATAGG + Intergenic
1112263792 13:97903579-97903601 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1114468814 14:22944479-22944501 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1114504650 14:23200328-23200350 CTGTCTCAAAAAAAAAAAGTTGG - Intronic
1115184839 14:30674637-30674659 CTGTCTCAAAAAAAAGAAGGAGG + Intronic
1115540303 14:34413250-34413272 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1116493098 14:45528790-45528812 CAGTCTCCCAAAATGGAATCAGG + Intergenic
1117855757 14:60030791-60030813 CTGGCTCACAAAAAGTCAATTGG - Intronic
1118179741 14:63480449-63480471 CTGTCTCAAAAAAAACAGTTGGG + Intronic
1118277975 14:64403117-64403139 CCGTCTCAAAAAAAAAAATTAGG - Intronic
1118645603 14:67835849-67835871 CTGTCTCAAAAAAAAGAAAGTGG + Intronic
1118692382 14:68352553-68352575 ATGTCTCACAGAAAGGACCTTGG - Intronic
1118879976 14:69817721-69817743 CCGTCTCAAAAAAAAGAACTTGG - Intergenic
1119025465 14:71148883-71148905 CTGTCTCAGAAAAGGGAGTCAGG + Intergenic
1119112876 14:71991354-71991376 CTCTCTCACAGATAGGAATGTGG - Intronic
1119533663 14:75381907-75381929 CTGTCTCACCTAAAGGGATGAGG + Intergenic
1120219675 14:81718191-81718213 CTGTCTCACATATAAGAACTAGG - Intergenic
1120650781 14:87130385-87130407 CTGTCTCCCAAAAATCATTTGGG - Intergenic
1120758938 14:88269132-88269154 CTGTCTCAAAAAAAAGAATACGG + Intronic
1122233304 14:100318102-100318124 CTGTCTCAAAAAAAAGAAAGAGG + Intergenic
1122570925 14:102700225-102700247 CTGTCTCAAAAAAAGAAAAAGGG - Intronic
1122663508 14:103313244-103313266 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1122777424 14:104127211-104127233 ATGTCTCAGGAAAAGGAATGTGG - Intergenic
1124948527 15:34293602-34293624 TTGTCTCAAAAAAATGAAATAGG - Intronic
1125013083 15:34901557-34901579 CTATCTCACATATAGAAATTTGG + Intronic
1125792532 15:42379304-42379326 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1125955034 15:43784755-43784777 CCGTCTCAAAAAAATTAATTAGG - Intronic
1126636127 15:50781664-50781686 CTTTCTCACAAAAAAGATTATGG - Intergenic
1126711939 15:51468223-51468245 ATTTCTCACAAAAAGGAACCAGG + Intronic
1127186878 15:56489573-56489595 GTGTTTCAGAAAGAGGAATTTGG - Intergenic
1127228651 15:56963810-56963832 CTGTGTCTCAAGGAGGAATTGGG + Intronic
1128255918 15:66196464-66196486 CTGTCTCAGAAAAAAAAAGTTGG + Intronic
1128278982 15:66378739-66378761 CTGTCTCAAAAAAAAAAATATGG - Intronic
1128923873 15:71636416-71636438 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1129120916 15:73396033-73396055 CTGTCTCACCAAGAGGACTGTGG + Intergenic
1129432433 15:75509681-75509703 CTGTCTCAAAAAAAATAATATGG + Intronic
1130867520 15:87945238-87945260 CTGTCTCACAAAAAGGAATTAGG - Intronic
1130922012 15:88355238-88355260 CTGTTTCAGAAACAGGAATGGGG - Intergenic
1131082057 15:89545109-89545131 CTGTCTCAAAAAAAAGAAGGAGG - Intergenic
1131204212 15:90427733-90427755 CTGTCTCCCAAAAAAAAAATGGG + Intronic
1132324562 15:100958024-100958046 CTGTCACACAAAAATTAGTTGGG - Intronic
1132650207 16:1017927-1017949 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1132878861 16:2152369-2152391 CTGTCTCAAAAAAATAAAATGGG + Intronic
1132948213 16:2544586-2544608 CCGTCTCAAAAAAAAAAATTTGG - Intronic
1133103061 16:3490818-3490840 CTGTCTCAAAAAAAAGAAAAGGG + Intergenic
1133281113 16:4665832-4665854 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1133296739 16:4757315-4757337 CTGTCTCAAAAAAACAAATTAGG - Intronic
1133556689 16:6912784-6912806 CTGTCTTAAAAAAAAAAATTAGG - Intronic
1133844505 16:9441407-9441429 TTGTCTCAAAAGAAGCAATTTGG - Intergenic
1134264088 16:12677634-12677656 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1134500894 16:14768413-14768435 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1134571714 16:15297023-15297045 CTCTCACATTAAAAGGAATTTGG - Intergenic
1134579688 16:15360636-15360658 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134670388 16:16050452-16050474 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1134715016 16:16353562-16353584 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1134722894 16:16396923-16396945 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1134730668 16:16459020-16459042 CTCTCACATTAAAAGGAATTTGG + Intergenic
1134747524 16:16599610-16599632 CTGTCTCAGAAAAAAGAAAATGG - Intergenic
1134790047 16:16981595-16981617 ATCTCACACAAGAAGGAATTTGG + Intergenic
1134936763 16:18252876-18252898 CTCTCACATTAAAAGGAATTTGG - Intergenic
1134944534 16:18314948-18314970 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134951799 16:18355097-18355119 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1134997946 16:18754047-18754069 CTGTCTCAGAAAAAAGAAAATGG + Intergenic
1135294194 16:21264954-21264976 AAGTCTCACAAAAAAGAAATTGG - Intronic
1135299796 16:21315682-21315704 CTGTCTCAAAAAAAAAAATAGGG + Intergenic
1135616649 16:23916762-23916784 CTGTTTCAAAAAAAAGAATGAGG - Intronic
1135671754 16:24381580-24381602 CTTTTTCCCAACAAGGAATTTGG - Intergenic
1135914714 16:26595525-26595547 CTGTCTCAAAAAAAGAAAGTGGG - Intergenic
1136072848 16:27798696-27798718 CTGTCCCACACTGAGGAATTGGG + Intronic
1136165961 16:28453303-28453325 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136197011 16:28661717-28661739 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136213350 16:28775840-28775862 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136258082 16:29055757-29055779 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1136320412 16:29480552-29480574 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136434985 16:30219892-30219914 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1136493254 16:30624752-30624774 CTGTCTTAAAAAAAAGAAATGGG - Intergenic
1136542270 16:30934651-30934673 CTGTCTCAAAAAAAAAAATGTGG + Intronic
1136549503 16:30975303-30975325 TCGTCTCAAAAAAAAGAATTGGG + Intronic
1138014990 16:53420080-53420102 ATCTCTCACAAGAAAGAATTTGG - Intergenic
1138041293 16:53671086-53671108 CTGTCTCAAAAAAAAGAGGTGGG + Intronic
1138785223 16:59837839-59837861 CTTTCTCACAGTAAGGACTTTGG - Intergenic
1139830223 16:69791526-69791548 CTGTCTCAAAAAAAGAAAAGAGG - Intronic
1140483627 16:75277019-75277041 CCGTCTCAAAAAAAAGAAGTGGG - Intergenic
1140876643 16:79158680-79158702 CTGACTTACAAAAAGCAATCAGG - Intronic
1141031158 16:80590127-80590149 CTGTCTCAGAAAAAGAAAACGGG + Intergenic
1142939158 17:3367095-3367117 CTGGCTCACAAAATAGAGTTTGG + Intergenic
1142972453 17:3621953-3621975 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
1143340499 17:6207260-6207282 CTGTCTCAAAAAAAAAAATGTGG - Intergenic
1143874788 17:9983484-9983506 CTGTCTCAAAAAATGAAAATAGG + Intronic
1143954963 17:10660978-10661000 CTGTCTCAAAAAAAAAAATAAGG - Intergenic
1144544300 17:16178197-16178219 CTGTCTCAAAAAAATAAAATAGG + Intronic
1145181698 17:20758860-20758882 CTGTCTCACAAAAAAAAAAAAGG - Intergenic
1145320231 17:21762439-21762461 ATTTCTCACTAAAAGGAACTAGG + Intergenic
1145410606 17:22658320-22658342 CTGTCTCAAAAAGATAAATTAGG - Intergenic
1146018927 17:29258531-29258553 CTGCCTCAGAAAGAGGAATTGGG - Exonic
1146072372 17:29694662-29694684 CCGTCTCACAAAGAGGATTATGG + Intronic
1146336139 17:31972276-31972298 CTCTGTCTCGAAAAGGAATTAGG + Intronic
1146459179 17:33031588-33031610 CTGTTTTACAAAAGGCAATTAGG + Intronic
1147601042 17:41745685-41745707 CTGTCTCACAAAATAAAAGTCGG + Intergenic
1147601113 17:41746143-41746165 CTGTCTCAAAAAAAAGAAGATGG - Intergenic
1147642523 17:42012798-42012820 CTGTCTCAAAAAAAAGGGTTGGG - Intronic
1147698655 17:42376839-42376861 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1148121518 17:45215138-45215160 CTGTCTCAAAAAAAAAAATGTGG - Intergenic
1148342686 17:46882981-46883003 CTGTCTCAAAAAAAAAAATGGGG - Intronic
1148544292 17:48505060-48505082 CTGTCTCACAAAAAAAAAAAAGG + Intergenic
1148598477 17:48875945-48875967 CCGTCTCACAAAAAAAAAGTAGG + Intergenic
1149764563 17:59264298-59264320 CTGTCTCAAAAAAAAAAACTTGG - Intronic
1150115592 17:62546181-62546203 CTGTCTCTACAAAAGAAATTAGG - Intronic
1150344981 17:64397728-64397750 CTGTCTCAAAAAAAAGATGTTGG - Intronic
1150426621 17:65082326-65082348 CTGTCTCAAAAAAAAAAGTTGGG + Intergenic
1150758237 17:67935421-67935443 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1150829250 17:68504459-68504481 CTGTCTCAAAAAAAGACATGTGG + Intergenic
1152051748 17:77984511-77984533 CTATCTCAAAAAAAAGAAGTAGG + Intergenic
1152674418 17:81630870-81630892 CTGTCTCAAAAAAAGAGATTAGG + Intronic
1152841219 17:82569863-82569885 CTGTCTAAAAAGAAAGAATTAGG + Intronic
1152959545 18:70933-70955 CTGTCTCAAAAAAAAAAAGTGGG + Intronic
1153113656 18:1626761-1626783 CCGTCTCATAAAAAATAATTAGG - Intergenic
1153215726 18:2819267-2819289 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1153308077 18:3651058-3651080 CTGTCTCAAAAAAACAAAGTTGG + Intronic
1153749013 18:8210304-8210326 CTGCCTCAAAAAAAGGGGTTGGG + Intronic
1155137317 18:23008644-23008666 ATTTCTCACTAAAAGGAACTAGG - Intronic
1156115071 18:33777847-33777869 CTGTCCCACAAAAAGTGTTTGGG + Intergenic
1156377138 18:36524861-36524883 CTGACTCACATAAAGCAATGAGG - Intronic
1156379192 18:36542042-36542064 CTGTTTTACAAATGGGAATTTGG + Intronic
1157115899 18:44862656-44862678 TTGGCTTACAAACAGGAATTTGG - Intronic
1157650274 18:49322065-49322087 CTTTCTCAAAAACAGAAATTAGG + Intronic
1157932802 18:51841828-51841850 CTGTCTCAAAAAAAAAAAATAGG - Intergenic
1158922891 18:62213916-62213938 TTGTCTCTCAAAAAGCATTTAGG - Intronic
1159098666 18:63935803-63935825 CTGTCTCAAAAAAATCATTTTGG + Exonic
1159491419 18:69139896-69139918 CTGTCTCAAAAAAAAAAATGTGG + Intergenic
1160702673 19:515730-515752 CTGTCTCAAAAAAAGAAAGAGGG + Intronic
1160780190 19:874116-874138 CTGTCTCAAAAAAAAAATTTAGG - Intronic
1161262586 19:3345991-3346013 CTGTCTCAAAAAAAAGAACAGGG + Intergenic
1161517894 19:4706809-4706831 TTGTCTCAAAAAAGGGAATGGGG + Intronic
1161522788 19:4734747-4734769 CTGTCTCAAAAAAATAAAGTGGG + Intergenic
1162115536 19:8427052-8427074 CTGTCTCAAAAAAAAGAAGAAGG - Intronic
1162264412 19:9559464-9559486 CTGTCTCAAAGAAAAAAATTAGG - Intergenic
1163345922 19:16742072-16742094 GTGTCTCAAAAAAAGTAAATAGG + Intronic
1163414392 19:17177194-17177216 CTGTCTCAAAAAAAAGTTTTTGG + Intronic
1163764263 19:19153755-19153777 CTGTCTCAAAAAAATAAATATGG - Intronic
1165026185 19:32963703-32963725 CTGTCTCAGACAAAGGAGTAAGG + Intronic
1165332403 19:35147986-35148008 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1165847561 19:38828233-38828255 CTGTCTCAAAAAAAAGAAAACGG - Intronic
1165927662 19:39336899-39336921 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1166027581 19:40102520-40102542 CTGTCTCAAAAAAAAGACTTTGG + Intergenic
1166135433 19:40774329-40774351 CTGTCTCAAAAAATTAAATTAGG + Intronic
1166773624 19:45299408-45299430 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
1166825008 19:45603080-45603102 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
1167089624 19:47334721-47334743 CTGTCTCAAAAAAAAAAAGTAGG - Intronic
1167192539 19:48001559-48001581 CTGTCTCAAAAAAAGGAGTGTGG - Intronic
1167279940 19:48561126-48561148 TTGTCTCAAAAAAATAAATTCGG + Intronic
1167802602 19:51754523-51754545 CTGTCTCAAAAAAAAAAAGTTGG - Intronic
925357862 2:3254898-3254920 CTGTATCACAAACAGGAAACTGG - Intronic
927228198 2:20791543-20791565 CACCATCACAAAAAGGAATTTGG - Intronic
927583277 2:24274568-24274590 CTGTCTCAAAATAAAGAAATGGG + Intronic
927601483 2:24446222-24446244 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
928811174 2:35228433-35228455 ATGTCTCTCATAAAGTAATTTGG + Intergenic
929059635 2:37910469-37910491 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
929183429 2:39068112-39068134 CTGTCTCAAAAATAAGAAGTGGG + Intronic
929535616 2:42782378-42782400 ATGTCTCACAAAGAGAAAATAGG - Intronic
930053106 2:47231919-47231941 CTGTCTCAAAAAAAAGAACAAGG + Intergenic
930064440 2:47317044-47317066 CTGTCTCAAAAAAAAAAGTTAGG - Intergenic
930069866 2:47357516-47357538 CTGTCTCATACAAAGCATTTCGG + Intronic
930326360 2:49924286-49924308 CTGTCTGCCAGAAAGGAATAGGG + Intronic
930491377 2:52076639-52076661 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
930794270 2:55371003-55371025 CTGTCTCAAAAAAAGGTCCTTGG + Intronic
931327366 2:61240576-61240598 CTGTCTCAAAAAAAAAAAATGGG - Intronic
932028167 2:68156809-68156831 TTGTCTCACACAAAGGAACACGG - Intronic
932655323 2:73606361-73606383 CTCAGTCACAAAATGGAATTAGG + Intronic
933693184 2:85195549-85195571 CTGTCTCAAAAAAAGAAAGAAGG - Intronic
934026818 2:88008148-88008170 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
934570994 2:95373297-95373319 ATGTCACACCAAAAGAAATTAGG + Intronic
935203637 2:100879672-100879694 CTGTCTCTAAAAAGGGAATCAGG - Intronic
935364681 2:102276818-102276840 CTGTCTCAAAAAAAAAAATGTGG + Intergenic
935638327 2:105267481-105267503 CAGGCTCACAAAAGGGATTTTGG + Exonic
935647925 2:105356568-105356590 CTGTCTCAAAAAAATAAAATAGG + Intergenic
936415185 2:112301291-112301313 CTCTGTCATAAAAAGGAATTTGG - Intronic
938043988 2:128100032-128100054 CTGTCTCAAAAAAAATAAGTAGG - Intronic
940563097 2:155326427-155326449 CTGTCTCACAAAAAAGAAAATGG + Intergenic
941937448 2:170996000-170996022 CTGTCTCAAAAAAACCAAATAGG - Intronic
942431943 2:175921162-175921184 CTGTCTCAAAAAAATAAAATAGG - Intergenic
942741753 2:179188637-179188659 CTGTCTCAAAAAAAGGGGTGGGG + Intronic
942932888 2:181517291-181517313 CTGTCTCCCTAAAATGAATTAGG - Intronic
944062208 2:195582080-195582102 CTGTGTCAAAAAGAGTAATTTGG - Intronic
944695785 2:202199275-202199297 CTGTCTCAAAAAAAGGGGGTTGG - Intergenic
946656664 2:221955859-221955881 CTGTCTTTCAGAATGGAATTAGG - Intergenic
946737963 2:222773483-222773505 CCTCCTCCCAAAAAGGAATTTGG + Intergenic
946924949 2:224617460-224617482 CTGTCTCAAAAAAAATAATAAGG - Intergenic
946980476 2:225208573-225208595 CTGTGTCACTAAAATGAATTGGG - Intergenic
947032854 2:225817774-225817796 CTGGCTCACAAAGAGAAATCAGG - Intergenic
947242659 2:228013254-228013276 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
947603077 2:231466363-231466385 CTGTCTCAAAAAAAAGAAACTGG - Intronic
947919936 2:233861297-233861319 CTGTCTCTTAAAAAGTAAATTGG + Intergenic
948161212 2:235826448-235826470 TTGTCTCAAAAAAAGGAGTGGGG - Intronic
1169095012 20:2889886-2889908 CTGTCTCAAAAAAAGGTATGGGG - Intronic
1169139160 20:3216883-3216905 CTGTCTCAAAAAAATAAAATAGG - Intronic
1169152396 20:3299906-3299928 CTGTGTCTCAAAAAAGAAATAGG - Intronic
1169348012 20:4844757-4844779 CTGTCTCAAGAAAAGGAAGGAGG + Intergenic
1169879080 20:10327610-10327632 CTGTCTCAAATAAAAAAATTTGG - Intergenic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1171363586 20:24608190-24608212 CTGTCTCAAAAAAAAAAAATAGG - Intronic
1171480084 20:25448122-25448144 CTCTATCTCAAAAAGAAATTAGG + Exonic
1172082004 20:32349396-32349418 ATGTCTCAAAAACAGGAAATAGG - Intergenic
1172089906 20:32423028-32423050 ATGTCTGACAAAAACGAAATGGG - Intronic
1172536651 20:35678696-35678718 TTGTCTCAAAAAAAAAAATTAGG + Intronic
1172744544 20:37196531-37196553 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1173163702 20:40671330-40671352 CTGTCTCACCACAAGGCATGTGG - Intergenic
1173360350 20:42338642-42338664 TTTTTTCAAAAAAAGGAATTTGG - Intronic
1174248871 20:49203035-49203057 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1174323693 20:49762256-49762278 TTCTCTCACAAGAAAGAATTCGG + Intergenic
1174616810 20:51841947-51841969 CTGTCTCAAAAAAAAGAAACAGG + Intergenic
1175458886 20:59135967-59135989 CTGTCTCAAAAAAAGTCAGTAGG + Intergenic
1175669165 20:60887006-60887028 CTGTCTCACAAGGTGGAAGTGGG - Intergenic
1175704431 20:61165751-61165773 CTGTCTCAAAAAAAAAAAATTGG - Intergenic
1182101619 22:27661759-27661781 CTGTCTCAAAAAAAAGAAGCCGG + Intergenic
1182218474 22:28739269-28739291 CTGTCTCAAAAAAAAGAAATGGG + Intronic
1182520961 22:30884369-30884391 CTGTCTCACAGAGAGGATGTGGG + Intronic
1182757267 22:32690167-32690189 CTGTCTCAAAAAAAGGAAAAAGG + Intronic
1182850234 22:33467686-33467708 CTGTCTCACTAAATGCCATTTGG - Intronic
1183812386 22:40268090-40268112 CTGTCTCAAAAAAAGAAAACTGG - Intronic
1183888220 22:40902830-40902852 CTGTCTCACAGCAAGGAGTCTGG + Intronic
1184895310 22:47403243-47403265 CTGTCTCAAAAAAAGAAAGGCGG + Intergenic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
1185404222 22:50637176-50637198 CTGTCTCACAAAAAAAAAGGAGG + Intergenic
949602503 3:5615513-5615535 CTGTCTCAAAAAAAAAAATAGGG - Intergenic
950581094 3:13862601-13862623 CTGTCTCACCAAGAGGAACCAGG + Intronic
951209484 3:19958932-19958954 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
952073095 3:29663010-29663032 CTGTCTGACAGAAAGTTATTTGG + Intronic
952413158 3:33067301-33067323 TTGTCTCAAAAAAAGAAATAAGG - Intronic
952446409 3:33385022-33385044 CTGTCTCAAAAAAAGAAAAAAGG + Intronic
953362927 3:42315352-42315374 CTGTCTCAAAAAAAAAAAGTGGG - Intergenic
954268173 3:49486517-49486539 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
954276948 3:49548473-49548495 CTGTCTCACAAACAAAAAATTGG - Intergenic
954559925 3:51548191-51548213 CTGTCTCAAAAAAAAGAAAGTGG - Intronic
955289838 3:57681457-57681479 CTGCCTCAAAAAAAAAAATTAGG + Intronic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
956183023 3:66534992-66535014 CTGTCTCAAAAAAAGAAAAAAGG - Intergenic
956696441 3:71922840-71922862 GTGTTCCACAAAAAGGAATAGGG + Intergenic
957486488 3:80869446-80869468 CTGTGTCACACTAAAGAATTTGG - Intergenic
957716158 3:83931542-83931564 GTTTCTCTCAAAATGGAATTTGG - Intergenic
958465523 3:94453163-94453185 ATGTCTCAAAAATAGGCATTTGG + Intergenic
959088828 3:101880772-101880794 CTGTCTCAAAAAAAAGAGATGGG - Intergenic
959802884 3:110516593-110516615 CTGTCTCAAAAAAAAAAAGTGGG - Intergenic
960022794 3:112974429-112974451 CTGTCTCAAAAAAGGGGGTTGGG + Intronic
960200177 3:114824486-114824508 ATGCCACACAAACAGGAATTCGG + Intronic
960468049 3:118023152-118023174 CTGTCTCATAAGAAGTAATTTGG + Intergenic
961230903 3:125307649-125307671 CTGTTTCAAAAAAAAGAATTAGG - Intronic
961797882 3:129422805-129422827 CTGTGAGACAAAAAGGAATGGGG - Intronic
961842664 3:129729807-129729829 CTATTTCATAAAAAGGAATGAGG + Intronic
965566643 3:170126544-170126566 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
966171941 3:177091433-177091455 CTTTTTCACTAAAAGGAATCAGG + Intronic
966387912 3:179421202-179421224 CTGTGAGAGAAAAAGGAATTAGG - Intronic
967428443 3:189354467-189354489 CTGTCTCGAAAAAAAGAAATAGG - Intergenic
967674291 3:192277765-192277787 CTGTCTCAAAAAAAGAAAACAGG - Intronic
967971172 3:195000630-195000652 GTGGCTCACAAAAATAAATTTGG + Intergenic
968176871 3:196558208-196558230 CTGTCTCAAAAAAATAAAATAGG - Intronic
968180492 3:196591679-196591701 CTGTCTCAAAAAAAAAGATTGGG + Intergenic
968448173 4:662996-663018 CTGTCTCAAAAAAAAGAAAGTGG + Intronic
968877393 4:3279778-3279800 CTGTCTCAAAAAAAAAAAGTAGG + Intergenic
969121137 4:4912250-4912272 CTGTCTCAAAATAAGTAAATAGG + Intergenic
971212385 4:24631558-24631580 CTGCCCTACAAAAAGAAATTTGG + Intergenic
971807240 4:31374808-31374830 TTGTCTAACATACAGGAATTTGG + Intergenic
972332444 4:38076432-38076454 CAGTCTCACATAAAGGGATCAGG - Intronic
972515183 4:39804829-39804851 CTGTCTCAAAAAAAATAAATAGG - Intergenic
972589845 4:40474423-40474445 ACGTCTTACAAAAAGGCATTTGG + Intronic
972677739 4:41276555-41276577 CTGTCTCAAAAAAAAAAGTTGGG - Intergenic
972678486 4:41283228-41283250 CTGTCTCACAAAAAAAGAGTGGG + Intergenic
972759472 4:42088931-42088953 CTGTCTCAAAAAGAGAATTTGGG + Exonic
973562340 4:52149728-52149750 CTGTCTCAGACAAATGAATGAGG + Intergenic
974060302 4:57027311-57027333 CTGTCTCAAAAAAAGGGAAGGGG - Intronic
974126151 4:57698024-57698046 CTGTCTCAAAAAAAAGAAAATGG + Intergenic
974258475 4:59493083-59493105 ATTTCTTTCAAAAAGGAATTAGG - Intergenic
974408195 4:61503995-61504017 CTGTCTTACAAAAAGGGGGTTGG - Intronic
974925893 4:68296871-68296893 CTCTCACACAAGAAAGAATTTGG + Intergenic
975691538 4:76969276-76969298 CTGTCTCCCAAATCAGAATTAGG - Intronic
976747884 4:88423426-88423448 CTGTCTTACACAAATGAATGTGG - Intronic
976958149 4:90930606-90930628 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
977430765 4:96928202-96928224 CTGTCTCTCAAAAAGAGAGTAGG - Intergenic
977808073 4:101326129-101326151 CTGTCTCCAAAAAAGGAAGGAGG + Intronic
978424728 4:108570170-108570192 CTGTCTCAAAAAAAAAAAATAGG + Intergenic
978569940 4:110126046-110126068 CTGTCTCACAAAAAAAAGATTGG - Intronic
979396311 4:120193710-120193732 CTGTCTCAAAAAAAGATAATAGG - Intergenic
979683177 4:123483626-123483648 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
980017055 4:127661770-127661792 CATTCTCAGATAAAGGAATTTGG + Intronic
980234552 4:130089062-130089084 CTATCTTCCAAAAAGGCATTTGG - Intergenic
980369802 4:131852611-131852633 CTGTCTCAAAAAAAAGAAGAAGG + Intergenic
980912076 4:139003059-139003081 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
981083122 4:140654955-140654977 ATGTCTAACAAAAGGGAACTAGG + Intronic
981510169 4:145547978-145548000 ATGTCCCACTAAAAGGAACTAGG + Intronic
981755537 4:148138386-148138408 CTGTCTCAAAAAAATAAAATAGG - Intronic
981867559 4:149442337-149442359 CTGTTGCACAAAAAGGAACCAGG - Intergenic
981903206 4:149890614-149890636 TTGCCTCACAAAGAGGCATTTGG + Intergenic
983472791 4:168176993-168177015 CTGTCTCAAAAAAAGAAAAATGG + Intronic
983592775 4:169433064-169433086 CTGTCTCACAAAAAATAAAGTGG - Intronic
983759327 4:171385530-171385552 CTGTCTCAAAAAAAGAAAAGCGG - Intergenic
984204067 4:176765035-176765057 CTGCCTCAAAAAAAAGAAATAGG + Intronic
984409160 4:179372708-179372730 CTGTTAAACAAAAAGGAATCAGG - Intergenic
984414176 4:179435756-179435778 TTGTCTCACAACAAGGAAGAAGG + Intergenic
984660567 4:182369871-182369893 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
984820982 4:183882181-183882203 ATGACTCCCAAAATGGAATTTGG + Intronic
986084090 5:4425670-4425692 CTGTGTAACACAAAGGAATGAGG + Intergenic
986270865 5:6229588-6229610 CTGACCCACAAAAAGGGATGTGG + Intergenic
986586978 5:9328778-9328800 CTCTCTCACAAAAAAGATTCTGG + Intronic
987109241 5:14669359-14669381 CCGTCTCAAAAAAAGAAAATAGG + Intronic
988128777 5:27076699-27076721 CTATTTCACAAAAAGGAGTTGGG + Intronic
988458481 5:31410467-31410489 CTGTTTCACACAAAGGGATGTGG + Intronic
988478725 5:31611479-31611501 CCGTCTTAAAAAAAGAAATTTGG - Intergenic
988588448 5:32528153-32528175 CTGTCTCAAAAAAAAAAAATGGG - Intergenic
988908042 5:35810213-35810235 CTGTCTCAAAAAAATAAAGTGGG - Intronic
989219250 5:38937037-38937059 CCGTCTCAAAAAAAGGTAGTTGG - Intronic
989385354 5:40849973-40849995 CTGTCTCAAAAAAAAAAAGTAGG + Intronic
989547972 5:42696668-42696690 TTGTGCCCCAAAAAGGAATTTGG + Intronic
989550638 5:42731726-42731748 CTGTCTCAAAAAAAGGGTTGGGG + Intergenic
989791064 5:45402478-45402500 CTGCCTCACAACAAAAAATTGGG + Intronic
990535143 5:56714323-56714345 TTGTCTCACAAAGAGAAAGTTGG - Intergenic
992564940 5:77987303-77987325 CTGTCTCAGAAAAAAAAATGGGG + Intergenic
994949734 5:106445776-106445798 CTGTCTCATAAAACAGATTTGGG - Intergenic
995689403 5:114806820-114806842 TTGACTCACAGAAAGGAAATAGG - Intergenic
996054779 5:118970419-118970441 CTGTCTCAGAAAAAGAAAAAAGG + Intronic
996067942 5:119100518-119100540 TTTTCTCAGAAAAATGAATTAGG - Intronic
997335183 5:133103064-133103086 CTGTCTCACAAAAAAGAAGGAGG - Intronic
997391091 5:133517070-133517092 CTGTCTCAAAAAAAAAAAATCGG + Intronic
997847283 5:137298482-137298504 CTGTTCCACAAAAATCAATTAGG + Intronic
997968044 5:138375676-138375698 CTGTCTCAAAAAAATAAAATAGG - Intronic
998033555 5:138893920-138893942 CTGTCTCAAAAAAAATAAATAGG - Intronic
998329850 5:141315725-141315747 ATGTCTCAGAAAAATGAGTTTGG + Intergenic
998450247 5:142228582-142228604 CTGTCTCAAAAAAAAAAAGTTGG + Intergenic
1000231849 5:159323089-159323111 CTGCTTCACAAAAAGGAAGATGG - Exonic
1000541387 5:162544740-162544762 GTGCCACACAAACAGGAATTGGG - Intergenic
1000859530 5:166439465-166439487 CTCTGTCTCAAAAAGAAATTTGG + Intergenic
1000897700 5:166875841-166875863 CTATTGCACAAAAAAGAATTGGG + Intergenic
1000913951 5:167057561-167057583 CTGTCCCACATAAAGGGAGTGGG - Intergenic
1000931521 5:167257461-167257483 TTGTCCCAGTAAAAGGAATTAGG - Intergenic
1001012972 5:168115286-168115308 CTGTCTCAAAAAAAGAAAGAAGG + Intronic
1001279021 5:170372627-170372649 TTGTCTCACAGAAAGATATTTGG - Intronic
1003230682 6:4250514-4250536 TTATCTCTCAAAAAGCAATTGGG + Intergenic
1005382629 6:25252422-25252444 CTGTCTCAAATAAAGGGAGTGGG + Intergenic
1005430205 6:25748679-25748701 CTGTCTCAGCAAGAGGAATGTGG + Intergenic
1005448459 6:25950605-25950627 ATCTCACACAAGAAGGAATTTGG + Intergenic
1005516481 6:26559440-26559462 CTGTCTCAAAAAAATTAAATAGG + Intergenic
1006032763 6:31189379-31189401 CTGTCTCAAAAAAATAAAATAGG - Intergenic
1006035396 6:31207543-31207565 CTCTGTCTCAAAAAAGAATTTGG + Intergenic
1006211554 6:32400071-32400093 CTGTCTCTCAAGAAGGTTTTAGG - Intronic
1006486664 6:34348475-34348497 CTGTCTCAAAAAAAAGAAACAGG + Intronic
1007108437 6:39299027-39299049 CTCTCTCACATAAAGGAGGTCGG + Exonic
1008156838 6:48026054-48026076 CTGTATCACCCTAAGGAATTTGG + Intronic
1008409411 6:51155861-51155883 CTATGTCACTAAAAGGACTTGGG - Intergenic
1009515689 6:64613978-64614000 CTGTCTCACCTAAGGGAATGGGG + Intronic
1009936753 6:70243530-70243552 CCGTCTCAAAAAAAAAAATTAGG - Intronic
1011271885 6:85588271-85588293 CTGTCTCAAAAAAATAAATAAGG + Intronic
1012444338 6:99292811-99292833 CTGTCTCAAAAAAAAGTCTTAGG - Intronic
1012994468 6:105959842-105959864 CTGTCTCAAAAAAAAAAATAGGG - Intergenic
1013565063 6:111350579-111350601 CTGTCTTATAAAAAGGGAATGGG - Intronic
1014740403 6:125142755-125142777 CTCTCTCAAAAAAAGAAATTGGG + Intronic
1015449291 6:133346456-133346478 CTTTCTGAGAAAAATGAATTTGG - Intronic
1015988449 6:138910357-138910379 CTGTCTCAAAAAAAGAAAAGAGG - Intronic
1016087431 6:139931427-139931449 CTTTCTTTCAAAAAGGATTTGGG + Intergenic
1016368780 6:143348651-143348673 CTATCTCCAAAAAAGGAATTGGG + Intergenic
1017699466 6:157054217-157054239 CTGTCTCAAAAAAAAGAAGGTGG + Intronic
1017892713 6:158652547-158652569 CTGTCTCAAAAAAATAAATAAGG - Intronic
1017921654 6:158878311-158878333 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1018055899 6:160051947-160051969 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1018812970 6:167310874-167310896 CTGTCTCACAAAAAAAATGTTGG + Intronic
1019230789 6:170560456-170560478 CTGTCTCAAAGAAAGGAAGCAGG + Intronic
1019467628 7:1198597-1198619 CTGTCTCAAAAAAAAAAATACGG - Intergenic
1020145523 7:5639466-5639488 CTGTCTCAAAAAAAAAAATGTGG - Intronic
1020146081 7:5644508-5644530 CTGTCTCAAAAAAAAAAAATGGG - Intronic
1020764576 7:12303890-12303912 CTGGCTCAAAAAAAGCAAGTAGG - Intergenic
1020799666 7:12718117-12718139 CTGTCTCAAAAAAAAGAAGAAGG - Intergenic
1021122357 7:16810859-16810881 CTGTCTTACAAGGTGGAATTAGG - Intronic
1021262243 7:18472527-18472549 CTGTATCACAAAAAGCAGTGGGG - Intronic
1021406624 7:20275432-20275454 CTGTCTCCCAAGAAGTACTTTGG + Intergenic
1022314301 7:29230343-29230365 CTGTCTCAAAAAAAAGAAAGAGG - Intronic
1023391282 7:39714082-39714104 CTGTCTCAAAAAAATTAATAAGG - Intergenic
1023421730 7:39987312-39987334 CTGTCTCAGAAAAAAGAAGTAGG - Intronic
1023452290 7:40300336-40300358 CAGTCTGGCGAAAAGGAATTTGG - Intronic
1023612677 7:41987161-41987183 CTGTCTCAAAAAAATAAAATAGG - Intronic
1024362137 7:48479240-48479262 CTGTCTCAAAAAAAGGAAAAAGG - Intronic
1025054136 7:55750788-55750810 CTGTCTCAGAAAAAAAAAATAGG + Intergenic
1026021253 7:66708288-66708310 CTGTCTCAAAAGAAAAAATTAGG - Intronic
1026051570 7:66951680-66951702 CTGTCTCTAAAAAAGTAAGTGGG - Intronic
1026197252 7:68183897-68183919 CTGTCTCAAAAAAAGAAAACAGG - Intergenic
1026354259 7:69543704-69543726 CTGTATCACTACAAGGAATGGGG - Intergenic
1026564859 7:71481443-71481465 CTGTCTCAAAAAAAAGAAAAAGG + Intronic
1027411229 7:77920684-77920706 CCGTCTCAAAAAAAGCATTTTGG - Intronic
1027655541 7:80926062-80926084 CTGTCTCACAAAAAATACCTGGG - Intergenic
1029052641 7:97705040-97705062 CTGTCTCAAAAAAAAAAGTTGGG - Intergenic
1029108102 7:98194687-98194709 ATTACTCACAAAAAGTAATTTGG + Intronic
1029655557 7:101922111-101922133 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1029713412 7:102312368-102312390 CTGTCTCAAAAAAAGGATACAGG + Intronic
1029863207 7:103597662-103597684 CTCTCTCACAAACAGAAGTTAGG + Intronic
1030336286 7:108330749-108330771 CTGTCTTCCAAAATGTAATTTGG + Intronic
1031022851 7:116647203-116647225 AAGTCTCTTAAAAAGGAATTTGG - Intergenic
1031620454 7:123928701-123928723 CTCTCTCACAAAGAGGAAAATGG + Intronic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1031919903 7:127592881-127592903 CTGACTCAGAAAAAGGAACCAGG + Intronic
1032057640 7:128696658-128696680 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1032877435 7:136052714-136052736 CTGTCTCACATAAGGGAAAGAGG - Intergenic
1033387677 7:140894127-140894149 CTGTCTCAAAAAAAAGAAATAGG + Intronic
1033636045 7:143212199-143212221 CTGTCTCAAAAAAAAAAAATGGG - Intergenic
1033656060 7:143375439-143375461 CTGTCTCAGAAAAAGGGAACAGG - Intergenic
1033878652 7:145854868-145854890 CTGTTTCACAAAAGGGTTTTAGG - Intergenic
1033967515 7:146994554-146994576 GTGACTCACATAAAGCAATTTGG + Intronic
1034191607 7:149217557-149217579 CTGTCTCAAAAAAAAAAATTGGG + Intronic
1034261722 7:149761040-149761062 CTCCCTCACAAACAAGAATTCGG + Intergenic
1034528676 7:151682243-151682265 TTGTCTCAAAAAAAGTAATGAGG - Intronic
1034532367 7:151704055-151704077 CTGTCTCAAAAAAAAAAATGTGG + Intronic
1034941508 7:155233658-155233680 CTGTCTTAAACAAAGGAAATAGG + Intergenic
1035196088 7:157221733-157221755 CTGTCTAAAAAAAAAAAATTTGG + Intronic
1036135581 8:6158026-6158048 CTGTGGCACAAATAGAAATTGGG + Intergenic
1037346044 8:17902306-17902328 CTGTCTCAAAAAAAAGAGTGAGG + Intronic
1037756693 8:21714829-21714851 CTGCCTGACACAAAGGAATGGGG + Intronic
1037767140 8:21779193-21779215 CTGTCTCAAAAAACGAGATTTGG + Intronic
1037869933 8:22484477-22484499 CTTTCTGACAAAATGGAATAAGG + Intronic
1038219751 8:25596025-25596047 CTGTCTCAAAAAAGGGAAAAAGG - Intergenic
1038722024 8:30045723-30045745 CTGTCTCAAAAAAAAAAATAGGG + Intergenic
1039484531 8:37900272-37900294 CTGTCTCAAAAAAATAAAGTTGG + Intergenic
1039724483 8:40201127-40201149 CAGTCTGAAAAAAATGAATTTGG - Intergenic
1040458988 8:47628768-47628790 CTGTCTAACAAAATGGAAATGGG + Intronic
1040681451 8:49815374-49815396 CTGTCTCAGTATAAGGAATTTGG - Intergenic
1040747451 8:50662706-50662728 AGGTTTCAGAAAAAGGAATTTGG + Intronic
1040884017 8:52239797-52239819 CTGTCTCAAAAAAGGGGTTTGGG - Intronic
1041319850 8:56601872-56601894 CTGTCTCACAAAAAGAAAAAAGG + Intergenic
1041373021 8:57183825-57183847 CTGTCTCAAAAAAAAAAAATCGG + Intergenic
1041724041 8:61001981-61002003 CTGTCTCAAAAAAAAAAAGTGGG - Intergenic
1042553401 8:70014098-70014120 CTGTCTCAGAAAAAGAAAAAAGG + Intergenic
1044545821 8:93457839-93457861 CTGTCTCAAAAAAAAGATGTGGG + Intergenic
1044653454 8:94523412-94523434 GTGTCTCAAAACAAGAAATTTGG - Intronic
1044668598 8:94655882-94655904 CTGTCTCGAAAAAATAAATTAGG + Intronic
1047025682 8:120821344-120821366 CTTTCTTACTAAAAGGAATCAGG - Intergenic
1048219404 8:132527593-132527615 CTCTCTCACACAGAGGCATTTGG + Intergenic
1048595197 8:135859069-135859091 CCGTCTCAAAAAAAAGAATTAGG + Intergenic
1049086031 8:140479280-140479302 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1049628656 8:143638894-143638916 CTATCTCAAAAAAAAGAAGTGGG - Intronic
1050738320 9:8790019-8790041 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1050922267 9:11218691-11218713 TTGACTTAAAAAAAGGAATTTGG + Intergenic
1050966898 9:11816085-11816107 CTACCTCACAAAAAGTTATTGGG - Intergenic
1051167884 9:14285125-14285147 CTGTCTCAAGAAAAGAAAATTGG - Intronic
1051595276 9:18818783-18818805 CTATCTCAAAAAAAAAAATTAGG + Intronic
1051859864 9:21612314-21612336 TTATTTCACAAAAAGAAATTAGG + Intergenic
1052143008 9:25010994-25011016 CTATCTCACAAATGGGAATAGGG - Intergenic
1053195745 9:36117081-36117103 CTGTGTCACAAACAGGATCTTGG - Exonic
1054995270 9:71380559-71380581 CTGTCTCCCTAAAAAGAAGTAGG - Intronic
1055524145 9:77113147-77113169 CTTTCTCACAAAAAGGAACCAGG + Intergenic
1055778200 9:79789587-79789609 CTTTCTCATGAAAGGGAATTTGG + Intergenic
1055936664 9:81610483-81610505 CTACCTCCCAAAAAGGAAGTGGG - Intronic
1057133684 9:92671816-92671838 CTGTCTCAAAAAAAAAAAGTGGG + Intergenic
1057135940 9:92687994-92688016 CTGTCTCAAAAAAAGGAGGAGGG - Intergenic
1057557862 9:96101928-96101950 ATCTCTCACAAGAAAGAATTCGG - Intergenic
1058061017 9:100496244-100496266 CTGTCTCAAAAAAAAGAACTTGG - Intronic
1058782140 9:108348766-108348788 CTGTCTCAAAAAAAAGAAAAAGG - Intergenic
1060008208 9:120019188-120019210 TTCTCTTACCAAAAGGAATTTGG - Intergenic
1060330095 9:122660327-122660349 CTTTTTCACCAAAAGGAGTTAGG + Intergenic
1060650460 9:125322068-125322090 CTGTCTCAAAAAAAAAAAATTGG - Intronic
1061285953 9:129622724-129622746 CTGTCTCACAAAAAAAAAAGAGG + Intronic
1061337503 9:129950796-129950818 CTGTCTCAAAAAAAAGAAAAAGG - Intronic
1062173301 9:135147412-135147434 CTTTCTCACAAAGATGAATGGGG + Intergenic
1062643988 9:137537315-137537337 CTGTCTCAAAAAAAAAAATGGGG - Intronic
1062731558 9:138113021-138113043 GTCTCTCACAAGAAGGAGTTGGG - Intronic
1185569456 X:1122033-1122055 CTGTCTCAAAAAAAAAAATGAGG + Intergenic
1185571296 X:1136883-1136905 CTGTCTCAAAAAAAAGAAAAGGG - Intergenic
1185592409 X:1286266-1286288 CTGTCTCATAAAATGCAATAAGG + Intronic
1185821130 X:3205800-3205822 CTGCCTCAAAAAAATGAAATAGG - Intergenic
1186118309 X:6328560-6328582 CTGTCTCAAAAAAAAGAAGAAGG + Intergenic
1186142836 X:6595080-6595102 CTGTCAAAAAAAATGGAATTGGG + Intergenic
1186161693 X:6783440-6783462 ATGTCACACAAGAAAGAATTCGG - Intergenic
1186808124 X:13160600-13160622 CTGTCTCAGAAAGAGGTATGAGG + Intergenic
1187188350 X:17009429-17009451 CTGTCTCAAAAAAAAAAAGTTGG - Intronic
1188165519 X:26858311-26858333 CTGTCTCAAAAAAAAAATTTGGG - Intergenic
1188178691 X:27026377-27026399 CTGTCTCAAAAAAAGGGGGTGGG - Intergenic
1188551107 X:31365503-31365525 CTGTGTTACAAAAAGGTACTTGG + Intronic
1188671910 X:32890663-32890685 TTGTCTAAAAAAAAGAAATTCGG + Intronic
1189074143 X:37898093-37898115 CTGTCTCAAAAAAAAAAATCTGG + Intronic
1189086126 X:38026453-38026475 ATCTCACACAAGAAGGAATTGGG + Intronic
1189283332 X:39834461-39834483 CTGTCTCAAAAAAAGAAAAAAGG + Intergenic
1189397353 X:40634896-40634918 CTGTTTTACAGAAAGGAAATAGG - Intronic
1189408669 X:40749615-40749637 CTGTTAAACACAAAGGAATTGGG + Intergenic
1189507185 X:41623711-41623733 CTGTCTCAAAAAAAAGAAAAGGG - Intronic
1189685336 X:43558059-43558081 TTCTCTCACTAAAAGGAAATAGG + Intergenic
1189863856 X:45302354-45302376 GTTTCTCCCAAAAAGGAGTTTGG - Intergenic
1190004005 X:46717383-46717405 GTGTCTCAAAAAAAAGATTTTGG - Intronic
1190075606 X:47314797-47314819 CTGTCTCAAAAAAAAGAACCAGG + Intergenic
1190852939 X:54264324-54264346 CTGTCTCAAAAAAAAAAAATTGG + Intronic
1190955242 X:55186753-55186775 CTGTCTCAGAAAGGGGAGTTGGG - Intronic
1191110150 X:56798174-56798196 CTTTCTCCCAAAAATGAATGCGG + Intergenic
1192456545 X:71281210-71281232 CTGTCTCAAAAAAAAAAAATTGG + Intergenic
1192528344 X:71867070-71867092 CTCTCTCACCAAGAGGAATGTGG - Intergenic
1192565032 X:72156439-72156461 CTGTCTCAAAAAAAGAAAGGTGG - Intergenic
1192776225 X:74248350-74248372 CTGTCTCAAAAAAAAGAAAAAGG + Intergenic
1193331204 X:80237465-80237487 CTGACTCAAAAAAAGCAAGTGGG + Intergenic
1193952540 X:87818304-87818326 CTGTCTCTCAACCAGGAAGTGGG - Intergenic
1194302278 X:92203016-92203038 CTGTCTCAAAAAAAAGAAGGGGG + Intronic
1195034269 X:100957162-100957184 CTGGTTCACAAAAAGGATTCTGG + Intergenic
1196914405 X:120517331-120517353 CTGTCTCAAAAAAAGAAAAGAGG + Intergenic
1197211031 X:123828369-123828391 CTGTCTCAAAAAAAATAAATAGG + Intergenic
1197315461 X:124960591-124960613 CAGTTTCATCAAAAGGAATTTGG - Intronic
1197427488 X:126315298-126315320 CTGTCTCAAAAAAGGCACTTTGG + Intergenic
1197661849 X:129181897-129181919 CTTTATCACTAAAAGGAATCAGG + Intergenic
1197829622 X:130627574-130627596 CTGTCTCAAAAAAAAAAGTTTGG + Intronic
1197859682 X:130957094-130957116 CTGTCTCACAAAATCCATTTTGG + Intergenic
1197883442 X:131193126-131193148 CTGGATCACAAAGAGGAACTGGG - Intergenic
1197979474 X:132200083-132200105 CTGTCTTAAAAAAAAGAAGTCGG + Intergenic
1198205642 X:134461973-134461995 CTGTCTCAAAAAAAAGAAATTGG - Intronic
1198699233 X:139379925-139379947 TTGTCACAAAAAAAGTAATTAGG - Intergenic
1198812749 X:140552164-140552186 CTGTCTCAAAAAAATGAAGTTGG - Intergenic
1199837357 X:151605177-151605199 CTGTCCCACTCAAAGGAATATGG - Intronic
1200245321 X:154520766-154520788 CTGTCTCAAAAAAATAAAATAGG + Intergenic
1200418643 Y:2938583-2938605 CCGTCTCAAAAAAAAGAAATTGG - Intronic
1201264837 Y:12195768-12195790 CTGTCTTTCAAAAGTGAATTAGG - Intergenic