ID: 1130872426

View in Genome Browser
Species Human (GRCh38)
Location 15:87982042-87982064
Sequence GGCCCTGGAAAGATCCGTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130872424_1130872426 -7 Left 1130872424 15:87982026-87982048 CCATGCAGCATTTGTGGGCCCTG 0: 1
1: 0
2: 4
3: 13
4: 185
Right 1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 74
1130872421_1130872426 3 Left 1130872421 15:87982016-87982038 CCTTTGGAGACCATGCAGCATTT 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130872426 Original CRISPR GGCCCTGGAAAGATCCGTGT CGG Intronic
904476640 1:30769297-30769319 GGCCCAGGAAAGTACCGTGACGG - Intergenic
904837636 1:33349586-33349608 GGCCCTGGACAGGTCAGTGCCGG - Intronic
906595149 1:47069279-47069301 GGCCGTGGCAAGATGTGTGTAGG + Intronic
922146433 1:222950120-222950142 TCCCCTGGAAGGATCCCTGTAGG + Intronic
922755869 1:228096718-228096740 GGCCCTGGAAGGTTCTGTGTTGG + Intronic
1065968173 10:30785298-30785320 GGCCCTGGGAAGATGCCTGGCGG - Intergenic
1067214838 10:44293223-44293245 GGCCCACGGAAGCTCCGTGTTGG + Intronic
1073581316 10:104668218-104668240 GGCCCTGGAAAGAACAAGGTTGG - Intronic
1074579513 10:114705384-114705406 AGCCATGGCAAGATCCCTGTGGG - Intergenic
1076764934 10:132627857-132627879 GGCCGTGGAGAGAGCCGTGTGGG + Intronic
1094443793 12:30507819-30507841 GGCACTGGAAAGATCAAGGTAGG - Intergenic
1096584680 12:52612172-52612194 AGCCCTGGAAAGCTGCCTGTGGG - Intronic
1102515865 12:113446282-113446304 GGCCCTGGGAAGGGCCCTGTAGG + Intergenic
1103951875 12:124555753-124555775 GGGCCAGGAAGGATCCGTCTCGG + Intronic
1104646305 12:130500157-130500179 GGCTCTGTAAAGAACCATGTGGG + Intronic
1104893664 12:132151790-132151812 GGCCTTGGAGAGCTCCCTGTGGG + Exonic
1104994595 12:132645565-132645587 GGCACTGGAATTAACCGTGTTGG + Intronic
1105592482 13:21806663-21806685 GGTCCTGGACATTTCCGTGTTGG + Intergenic
1106521247 13:30499546-30499568 GACAATGGAAAGATCAGTGTTGG - Intronic
1113032641 13:106011309-106011331 AGCCCTGGAAAGCTCATTGTTGG - Intergenic
1113643669 13:111976539-111976561 GGCCAGGAAAAGATCCCTGTAGG - Intergenic
1114460231 14:22882000-22882022 GGCACTGGAAAGATGTGGGTGGG + Intergenic
1121680019 14:95786036-95786058 TGCCTTGGAAAGATCCCTCTGGG - Intergenic
1121998075 14:98621393-98621415 GGCCCTGAAAAGATTCTTCTTGG - Intergenic
1122904062 14:104793933-104793955 GGCTGTGGAAAGACCCATGTTGG - Exonic
1123981378 15:25607715-25607737 GGACCTGGAAAGTTCTGTGCTGG + Intergenic
1129671828 15:77611958-77611980 GGCCCTGGGAAGAACCCTGGTGG + Intergenic
1130872426 15:87982042-87982064 GGCCCTGGAAAGATCCGTGTCGG + Intronic
1132535182 16:475542-475564 TGCCCTGGAAAACTCCATGTAGG + Intronic
1134027544 16:10965842-10965864 GGCCCTGGAAAAGTCCCTGCTGG + Intronic
1134572174 16:15300557-15300579 CACGCTGGAAAGATCCATGTTGG - Intergenic
1134730207 16:16455491-16455513 CACGCTGGAAAGATCCATGTTGG + Intergenic
1134937224 16:18256408-18256430 CACGCTGGAAAGATCCATGTTGG - Intergenic
1142109122 16:88321992-88322014 GGCCCTGGCGAGATCTCTGTGGG + Intergenic
1142760777 17:2040894-2040916 TGCCCTGGAAAGCTCATTGTCGG + Intronic
1143601311 17:7948013-7948035 GGCCTAGGAAAGATCGGAGTTGG + Intronic
1143769491 17:9158929-9158951 GGCCCTAGAAAAAGCAGTGTGGG - Intronic
1150217322 17:63477795-63477817 GGCCCTGGGGAGATCCCTGCGGG - Intergenic
1157114597 18:44851255-44851277 GGCCCAGGAAAGCTTCCTGTAGG + Intronic
1166171740 19:41032620-41032642 GACCCTGGAAAGTGCCTTGTGGG + Intergenic
1166431221 19:42729620-42729642 TGCCCTGGGAAGATCTGGGTAGG - Intronic
1167614672 19:50525861-50525883 GGCCCTAGAAAGGTCTGTTTAGG + Intronic
928834087 2:35522562-35522584 AGCCCTGGAAAGATGCCTGGAGG + Intergenic
931774982 2:65532834-65532856 GGGTCTGGAAAGATCAGTGAGGG - Intergenic
931838543 2:66125793-66125815 GGCACTGGAAAGATTCTTGCTGG - Intergenic
1169213129 20:3778586-3778608 GGCCCTGGAAGGGTGAGTGTAGG - Intronic
1174774020 20:53326944-53326966 GTCCCTGGAAAGATCCAAGGAGG + Intronic
1182356830 22:29726007-29726029 GGCCCAGGAAAGCTCCAGGTGGG + Intronic
1184453662 22:44597324-44597346 GGCCCGGGACAGGTCCGAGTGGG + Intergenic
1185024719 22:48402339-48402361 GGCTTTGGAGAGATCCGTGGAGG + Intergenic
950047953 3:9962020-9962042 TGCCCTGGAAAGGTCCAGGTTGG - Intergenic
950521294 3:13499536-13499558 GGCCATGGAAAGATGCGTACTGG + Intronic
962163585 3:133025491-133025513 TGCCCTTGAAAGATCCTTGGAGG - Intergenic
967895139 3:194389338-194389360 GGACTTGGAAAGATCCATGCTGG + Intergenic
976838907 4:89408073-89408095 TGGCCTGGTAAGATCCATGTTGG + Intergenic
982418065 4:155160525-155160547 GGACCTGGAAAAATCCCTCTGGG + Intergenic
985658835 5:1145530-1145552 GGTCCTGGAAAGGTCAGTGAAGG - Intergenic
985975346 5:3415825-3415847 GGCCCTGGATAGGTCCAAGTAGG - Intergenic
991298227 5:65103237-65103259 GGCCCTGGAAAGTTCTGGGACGG + Intergenic
996113811 5:119596491-119596513 GGCCTGGGAATTATCCGTGTGGG + Intronic
997306179 5:132838305-132838327 GGCCCCGGACAGATAGGTGTGGG + Intergenic
1002454025 5:179336108-179336130 GGAAATGGAAAGATGCGTGTTGG - Intronic
1007063969 6:38970379-38970401 GGAGCTGGAAAGATTCATGTGGG + Intronic
1007596121 6:43052467-43052489 GGCCCTGGACAAATCTGTGCTGG - Exonic
1012532434 6:100253962-100253984 AACTCTGGAAAGATCCCTGTAGG - Intergenic
1013402331 6:109810825-109810847 GTCCCAGGAAAGATGCTTGTGGG + Intronic
1013871640 6:114769343-114769365 TGCCCTGGAAAGACCTGTGAAGG + Intergenic
1018949368 6:168369186-168369208 GGCACTCGAAAGATGGGTGTGGG - Intergenic
1022206856 7:28173086-28173108 GGCCCTGGAAAGTGCTGGGTGGG + Intronic
1029236728 7:99126001-99126023 GGCTCTAGAAAGATCTGGGTGGG - Intronic
1030065447 7:105655697-105655719 GGCCCTGGCCAGATGCCTGTGGG - Intronic
1032000693 7:128263257-128263279 GGCCCTGGGAAGATTAGGGTAGG - Intergenic
1036826230 8:11978204-11978226 GGCTCTGGAAAGCTCCCAGTAGG + Intergenic
1037943974 8:22975016-22975038 GGCCCTGGAAAGAGATGTCTAGG - Intronic
1049496752 8:142939222-142939244 GGCCCTGGGGACATCCTTGTGGG - Intergenic
1050103082 9:2138813-2138835 GGCCCTAGAAAGAACCATGTGGG + Intronic
1062437018 9:136550906-136550928 GGTCCTGGAAAGGTCTGAGTGGG - Intergenic
1193150064 X:78115717-78115739 GGCCCTTAAAAGATCAATGTGGG - Intronic