ID: 1130872673

View in Genome Browser
Species Human (GRCh38)
Location 15:87983632-87983654
Sequence ACTTTGCCACAAAGTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130872673 Original CRISPR ACTTTGCCACAAAGTGAACT TGG (reversed) Intronic
900903670 1:5535378-5535400 ACTTTGCCAACAATTGACCTTGG + Intergenic
903394010 1:22985485-22985507 CCTATGGCTCAAAGTGAACTAGG - Intergenic
903473385 1:23603032-23603054 TAGTTGACACAAAGTGAACTTGG + Intronic
904780060 1:32939714-32939736 ACTGTGCAACAAAGTGATGTTGG - Intronic
905131428 1:35761966-35761988 ATTTTGCCTCAAAGTTTACTGGG + Intronic
908297206 1:62724638-62724660 AATTTGCCACACAGTCAACCAGG + Intergenic
908749885 1:67411124-67411146 CTCTTGACACAAAGTGAACTAGG + Exonic
909882387 1:80896310-80896332 AATTTGCCCAAAAGTGTACTTGG + Intergenic
911678962 1:100692071-100692093 ACTTTGTAACAATTTGAACTGGG - Intergenic
912197884 1:107421538-107421560 CATTTGTCACAAAGTGAAATGGG - Intronic
914965240 1:152251582-152251604 AATTTGGAACAAAGTCAACTGGG - Intergenic
915635876 1:157186206-157186228 ACTTTGCCAGAAGCTGTACTTGG - Intergenic
916820347 1:168392394-168392416 TGTTTGCCAGAAAGAGAACTGGG + Intergenic
918598974 1:186330502-186330524 ACGCTGCCCCAAAGTGAACATGG + Intronic
920136029 1:203770086-203770108 ACTTGGCCACAAAGTGTGATAGG + Intronic
920267110 1:204732244-204732266 ACCCTGCCCCAAAGTGAACACGG - Intergenic
921265352 1:213416994-213417016 ACTTTGCCCCAAAGTGCACAGGG - Intergenic
922135060 1:222816382-222816404 TTTTTGCCACAAAGTGAGCAAGG + Intergenic
923065183 1:230510783-230510805 ACCCTGCCCCAAAGTGAACATGG - Intergenic
923249746 1:232168849-232168871 ACCCTGCCCCAAAGTGAACATGG + Intergenic
1063237335 10:4130742-4130764 ACCCTGCCCCAAAGTGAACACGG + Intergenic
1063497030 10:6519731-6519753 ACTGTGCCCCAAAGTGAACATGG + Intronic
1064341439 10:14489186-14489208 TCTCTGCCCCAAAGTGAACATGG + Intergenic
1064365778 10:14706524-14706546 ACTTCACCCCAAAGTGAACTGGG + Intronic
1068653161 10:59545622-59545644 TCTTTGCCAGAAATTGCACTAGG - Intergenic
1069177741 10:65314434-65314456 ACATTGCCTCAAACTGGACTTGG - Intergenic
1071096308 10:81979239-81979261 ACATTGACACAAAGTTACCTGGG - Intronic
1071398244 10:85244168-85244190 ACTTTTCAAGAAAATGAACTGGG + Intergenic
1071773979 10:88763995-88764017 ACTTTGACATAAAAAGAACTGGG + Intronic
1074517804 10:114187126-114187148 ACTTTGTGACAAATTAAACTTGG + Intronic
1080376932 11:31723684-31723706 GCTTTACCACACAGTGATCTTGG - Intronic
1081185470 11:40036997-40037019 ACCCTGCCCCAAAGTGAACATGG - Intergenic
1081826344 11:46057116-46057138 CCTTAGGCACAAAATGAACTTGG - Intronic
1085886034 11:80523235-80523257 ACTGTGCCAGACATTGAACTAGG + Intergenic
1085967701 11:81548628-81548650 ACTTAGCCAAAAAGTAAAGTGGG + Intergenic
1087037077 11:93766515-93766537 ACCTTACCCCAAAGTGAACGTGG - Intronic
1087546109 11:99585703-99585725 ACTTTAGCACAAAGTTAAATGGG + Intronic
1087647739 11:100827823-100827845 ACTATGCCCCACAGTGATCTTGG + Intronic
1091005162 11:131946393-131946415 ACATTGCCACAAGGTCAAATAGG + Intronic
1091029992 11:132177456-132177478 ATTTTGCCACAAAGTGGAATAGG + Intronic
1091093076 11:132791624-132791646 ACCCTGCCTCAAAGTGAACATGG + Intronic
1091337468 11:134783151-134783173 TCTTTGCGACAAAGTGAAGCAGG + Intergenic
1091851924 12:3706396-3706418 TCTTTGACACATAGTGAAGTAGG + Intronic
1091852570 12:3712190-3712212 ACTTTGCCACCCTGTGACCTTGG + Intronic
1093010464 12:14101628-14101650 ACTTTGTAACAATTTGAACTGGG + Intergenic
1094587723 12:31793440-31793462 AATATGCCACAAAGTGAGCCAGG + Intergenic
1094627395 12:32136863-32136885 ACTCTGGCACAAAGTGGACAAGG - Intronic
1097994001 12:65867607-65867629 ACTTTTACACAACTTGAACTTGG - Intronic
1098074367 12:66712679-66712701 CCTTTGCCACTACGTGACCTGGG + Intronic
1098117398 12:67194305-67194327 AGTCTTCCACAAACTGAACTGGG - Intergenic
1098960990 12:76739515-76739537 ACTTTGCAACAATTTGAACGGGG - Intergenic
1099923586 12:88989470-88989492 ACTTTTTCACAGAGAGAACTAGG + Intergenic
1101420746 12:104548894-104548916 CCTTTTCAGCAAAGTGAACTAGG + Intronic
1103501311 12:121404927-121404949 ACTGTGCCAGAAAGAGAGCTGGG + Intronic
1104449557 12:128858000-128858022 ACTGAGCCACAAAGCAAACTTGG - Intronic
1106242369 13:27921748-27921770 CCTTAGCAAGAAAGTGAACTAGG - Intronic
1106650223 13:31682587-31682609 ACTTTGCCGCAAGGTGAATACGG + Intergenic
1108088078 13:46817091-46817113 ACCTTGCCCCAAGGTGAACATGG - Intergenic
1108352913 13:49603452-49603474 AATTTGCCCCAAAGTTACCTTGG + Intergenic
1109508461 13:63337201-63337223 ACTTTGTAACAATTTGAACTGGG - Intergenic
1111624781 13:90770849-90770871 ACCTTGCCAAAAAGTCAACCAGG - Intergenic
1112964046 13:105165093-105165115 CCTCTGCCACAAAGGGAACAGGG + Intergenic
1113793577 13:113043504-113043526 CCTTTTCCACAAAGGGACCTTGG - Intronic
1114317196 14:21520224-21520246 ACTTTGCCACTGAGTGACTTTGG + Intergenic
1114692381 14:24595797-24595819 ACTTTGCAACAATTTGAATTGGG - Intergenic
1115389351 14:32836924-32836946 ACTTGGCCTCAAAGTGATGTTGG + Exonic
1119078555 14:71669737-71669759 TCTTTGTCATGAAGTGAACTAGG + Intronic
1122069921 14:99199377-99199399 ACTTCGCCTCTAATTGAACTGGG - Intronic
1124557057 15:30736070-30736092 ACTTTGTAACAATTTGAACTGGG + Intronic
1124674201 15:31669674-31669696 ACTTTGTAACAATTTGAACTGGG - Intronic
1128964214 15:72041292-72041314 AAACTGCCAGAAAGTGAACTAGG - Intronic
1129111208 15:73338366-73338388 ACTCTGCCACACATGGAACTTGG + Intronic
1130872673 15:87983632-87983654 ACTTTGCCACAAAGTGAACTTGG - Intronic
1131550716 15:93354486-93354508 GCTTTGCCAAAAATTGAAATGGG + Intergenic
1132000250 15:98172190-98172212 AAGTTGCCCCAAAGTTAACTGGG + Intergenic
1133478234 16:6144299-6144321 AATTTGCCACAAACTGAAGCAGG - Intronic
1135638113 16:24096294-24096316 AATTTGTCACAAAGTTAACTTGG + Intronic
1136470554 16:30477034-30477056 ACTTTGCAACCATGTGACCTTGG - Intronic
1138743516 16:59337177-59337199 TCTTTTCCATAAAGTAAACTTGG - Intergenic
1139126465 16:64084025-64084047 ACTGTGGCACAAAGGGAACCAGG - Intergenic
1139812414 16:69633112-69633134 ACATTGCCAAAAAGCAAACTTGG + Intronic
1140626497 16:76801037-76801059 ACTTTCCCACAAACTTACCTGGG - Intergenic
1141200905 16:81896803-81896825 TCTTTGCCACAAAGTGAGTATGG + Intronic
1141812598 16:86385432-86385454 ACTTTCACCAAAAGTGAACTTGG + Intergenic
1144346013 17:14350626-14350648 AATTTGCCACTTAGTGAAATAGG + Intergenic
1148083207 17:44978767-44978789 AGTTTGCCACAAAGTGCTATTGG + Intergenic
1150208258 17:63425997-63426019 TCTTTGCCACAAAATGGAATAGG + Exonic
1150538887 17:66076168-66076190 ACTTTGTAACAATTTGAACTGGG + Intronic
1151193326 17:72414232-72414254 TCTTTGCCAGACAGTGAGCTTGG - Intergenic
1153566776 18:6426803-6426825 ACTCTGCCCCAAAGTGAACATGG - Intergenic
1153668016 18:7383689-7383711 ATTTAACCAAAAAGTGAACTGGG - Intergenic
1156277128 18:35594136-35594158 ACTTTGCCTGAAAGTTACCTTGG + Intronic
1157022888 18:43808126-43808148 ACTTTCTCACAAAGTGAATGTGG + Intergenic
1157104819 18:44764110-44764132 ACTTTTGCACAAAATGAAATGGG - Intronic
1157490343 18:48119487-48119509 ATTTTCCAACAAAGTGCACTTGG + Intronic
1160879069 19:1311320-1311342 ATTTTCCCACAAGGTGGACTCGG + Intergenic
1161214632 19:3087813-3087835 ACTTTGTCACAATTTGAAATGGG - Intergenic
1167766379 19:51485456-51485478 CCTTTGCTACCAAGTGAAGTTGG + Intronic
1168676925 19:58285305-58285327 ACTTAGATACAAAGTGAAATTGG - Intronic
925127409 2:1469495-1469517 ACTTTGTAACAATTTGAACTTGG - Intronic
926872811 2:17441548-17441570 ACTTTGTAACAATTTGAACTGGG - Intergenic
927131460 2:20063918-20063940 TTTTTGCCACAAAGTGTTCTTGG - Intergenic
929381105 2:41355319-41355341 ACTTTGCCACACTTAGAACTAGG + Intergenic
931872959 2:66481332-66481354 GCTTTCCCACAAAGTGGCCTGGG - Intronic
936676757 2:114724605-114724627 ACTCTACCTCAAAGTGAACATGG - Intronic
937185831 2:120041270-120041292 ACATTGCAACACAGTGAACGTGG - Intronic
938402397 2:131004559-131004581 ACTCTGCCACCAAGTGGGCTTGG - Intronic
938801181 2:134764837-134764859 TCTCTGCCCCAAAGTGAACATGG + Intergenic
940431282 2:153593044-153593066 ACTTTGTAACAATTTGAACTGGG + Intergenic
942219141 2:173752410-173752432 ATTTTGCCACCCAGTGAAATGGG - Intergenic
943289248 2:186047492-186047514 ACTTTGCCTGAAAATGAATTTGG + Intergenic
945864471 2:215161329-215161351 ACTTTGTAACAATGTGAACGGGG + Intergenic
1175501727 20:59455598-59455620 GCTTTGGCACACAGTGCACTGGG + Intergenic
1177885049 21:26736828-26736850 TCTCTGCCCCAAAGTGAACATGG + Intergenic
1178163563 21:29946506-29946528 ACATTGCCTTAAAGGGAACTTGG + Intergenic
1181014130 22:20058922-20058944 ACCCTGCCCCAAAGTGAACATGG - Intronic
1181809623 22:25395475-25395497 ACTTTTCCCCAGAGAGAACTTGG - Intronic
1181816766 22:25443787-25443809 CTCTTGACACAAAGTGAACTAGG - Intergenic
1184055673 22:42047177-42047199 CTCTTGACACAAAGTGAACTAGG - Intronic
1184301127 22:43561639-43561661 GCTTTGCTAAAAAGTGAAATGGG - Intronic
949290661 3:2461807-2461829 AGTTTGCCTCTAAGTGAAATGGG - Intronic
950603615 3:14058151-14058173 ACTTTGTAACAATTTGAACTGGG - Intronic
953856862 3:46505942-46505964 CCTTTGCCAAAGAGTGAGCTAGG - Intergenic
957530121 3:81430131-81430153 ACTTTGAGAGGAAGTGAACTTGG + Intergenic
958960760 3:100507377-100507399 ACTTTCCCACAAATTCATCTGGG - Intronic
959381296 3:105644130-105644152 ACTTTCCCACATAGGGTACTAGG - Intergenic
959812873 3:110639501-110639523 ATTTTGGAACAAAGTGTACTTGG - Intergenic
959997195 3:112693091-112693113 ACTTTGTAACAATTTGAACTAGG + Intergenic
960023852 3:112987057-112987079 AGTTTACCACAAAGTTAACAAGG - Intergenic
960721973 3:120633275-120633297 GCTTTGCCTCATAGTGACCTCGG + Exonic
965022766 3:163255045-163255067 TCTTTGCCACATAGTAAACTAGG + Intergenic
965449939 3:168825249-168825271 ACATTTCCACAAGGTTAACTTGG + Intergenic
966959500 3:184920547-184920569 CCTTAGCAACAAAGTGAAGTTGG - Intronic
967644429 3:191904052-191904074 ACATTGACACAATGTGAAATGGG + Intergenic
971701000 4:29976011-29976033 ACTTCGTCACAAAGTAATCTTGG + Intergenic
971862775 4:32129577-32129599 ACTTTGTTGCAAAGTGTACTGGG - Intergenic
972150575 4:36084436-36084458 ATTTTGCCACCAAATGAGCTGGG + Intronic
972770780 4:42195012-42195034 TCTTTGCCACAAATTCATCTTGG - Intergenic
975041890 4:69755325-69755347 AATTTGTCACAAAGTAAAATTGG + Intronic
978266293 4:106829953-106829975 ACTATGCCAAAAAGTCAACAAGG + Intergenic
978726765 4:111978002-111978024 ACTTTGCAACAATTTGAACGGGG - Intergenic
980717207 4:136641754-136641776 ATATTTCCATAAAGTGAACTGGG - Intergenic
982672189 4:158334240-158334262 AAGTTGCCACAAATTGAAATGGG + Intronic
985131631 4:186744303-186744325 AATTAGCCAGAAAATGAACTCGG + Intergenic
985977784 5:3434664-3434686 TCTTTTCCACAAAGTAAACTGGG - Intergenic
991126400 5:63074648-63074670 AGTTTGCCAAAAAGGGATCTAGG + Intergenic
991386880 5:66100805-66100827 ACTTTGTAACAATTTGAACTGGG + Intergenic
993111515 5:83662784-83662806 ACTTTACCACAAAGTGGAAGTGG - Intronic
994701863 5:103143483-103143505 ACTTTGCCACAAAGGAAGATAGG + Intronic
1000656754 5:163888700-163888722 ACCCTGCCCCAAAGTGAACATGG + Intergenic
1001060447 5:168483854-168483876 AATTTTCCACAAAGTTAGCTTGG + Intergenic
1001717039 5:173824775-173824797 AATTTTCCACAAAGTGAATCAGG + Intergenic
1003207133 6:4022777-4022799 ATTGTGCCACACAATGAACTTGG - Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006997276 6:38273233-38273255 ACTGTACTACAAAGTGTACTGGG - Intronic
1008258275 6:49332075-49332097 ACTTTGCCACAATATGAGCAGGG - Intergenic
1012798898 6:103800409-103800431 ACTTTGACATAAAGTGAAATTGG - Intergenic
1014678277 6:124395671-124395693 ACTTTACCTAAAAGTGAAATGGG - Intronic
1015374169 6:132491214-132491236 ATGTTGCCACAAAGTGAATATGG + Intronic
1015501353 6:133936964-133936986 ACTTTGTAACAATTTGAACTAGG - Intergenic
1016226325 6:141743281-141743303 ACTTAGCCAAAAATTTAACTGGG + Intergenic
1016726011 6:147368111-147368133 ACTTTTCCAAAAACTGAATTAGG + Intronic
1017107446 6:150901112-150901134 ACTTTGCCACAAGGTAGTCTAGG + Intronic
1017160178 6:151358480-151358502 AATTTGCCCCAAACAGAACTAGG - Exonic
1017994239 6:159518303-159518325 ACATTGCAACTAAGAGAACTAGG - Intergenic
1018009341 6:159655430-159655452 ACTTTGTAACAATTTGAACTGGG + Intergenic
1018879679 6:167864606-167864628 ACTTTGCAACAAAATGTATTCGG + Exonic
1020279076 7:6641225-6641247 ACTTGGCCACACAGAGCACTGGG - Intronic
1021115081 7:16738388-16738410 ACTTCACCACAAAGTGTACATGG + Intergenic
1022818759 7:33938268-33938290 ACTCTGCCACCCAGTAAACTTGG - Intronic
1023169853 7:37379963-37379985 ACTATGCCCCAAAGTGAATGTGG + Intronic
1024389359 7:48789464-48789486 ACTTTGCTAAAAAGGGCACTTGG - Intergenic
1024507418 7:50173914-50173936 ACTATGCTCCAAAATGAACTCGG - Intergenic
1026290486 7:69001612-69001634 AATTTACCACAAAGTTAGCTTGG + Intergenic
1027985048 7:85276859-85276881 ACTCTGCTCCAAAGTGAACATGG - Intergenic
1031354266 7:120770663-120770685 ACTGTGCCAGAAACTGTACTGGG + Intergenic
1032996892 7:137456852-137456874 ACTCTTCCACTAACTGAACTTGG + Intronic
1034301451 7:150018758-150018780 ACTTTGTCACTAAATGAGCTTGG + Intergenic
1034804596 7:154078522-154078544 ACTTTGTCACTAAATGAGCTTGG - Intronic
1038586987 8:28798808-28798830 ACTTTTCCATAAATTTAACTGGG + Intronic
1041713173 8:60911213-60911235 AGGTTGCCCCAAAATGAACTTGG + Intergenic
1042013424 8:64277516-64277538 ACTTTGCAATAATGTGTACTTGG - Intergenic
1046847398 8:118933411-118933433 GATTTGCCACAAAGTAAGCTTGG + Intronic
1047130823 8:122017821-122017843 ACTTTGTGACAAATTGAACAGGG - Intergenic
1048489812 8:134882298-134882320 ACTTTGCCAAAGAGGGAACTAGG + Intergenic
1050290623 9:4150442-4150464 AGCTTGCCACAGACTGAACTTGG - Intronic
1052657249 9:31378504-31378526 TTATTGCCAAAAAGTGAACTTGG + Intergenic
1053430566 9:38039478-38039500 CCTTTGCCACAAAGTGGGATGGG - Intronic
1054937247 9:70700942-70700964 ACTTTTCCACAAAGAACACTTGG + Intronic
1057393854 9:94661887-94661909 ACATTGGCAAAAATTGAACTTGG - Intergenic
1059593123 9:115685670-115685692 AGTCTGCCACAAAGAGAACAGGG - Intergenic
1061182481 9:129032973-129032995 AATTCACCACAAAGTGAACATGG - Intergenic
1061887526 9:133599354-133599376 ATTGTGCCACAAAGGGAACCTGG + Intergenic
1185812498 X:3123768-3123790 ACATAGCCCCAAAGTGAACATGG - Intergenic
1187743831 X:22386621-22386643 ATTCTGCCACAAAGTGAAAAAGG - Intergenic
1188703578 X:33297673-33297695 GATTTGCAACAAGGTGAACTTGG + Intronic
1188811826 X:34660397-34660419 ACCCTGCCCCAAAGTGAACATGG - Intergenic
1189218101 X:39344689-39344711 ACTTTGTAACAATTTGAACTGGG + Intergenic
1190573239 X:51806280-51806302 GCATTCTCACAAAGTGAACTCGG + Intronic
1192069133 X:67918439-67918461 ACTTTGTAACAATTTGAACTGGG - Intergenic
1192804916 X:74500059-74500081 ACCTCACCCCAAAGTGAACTTGG - Intronic
1193671052 X:84386912-84386934 ACTTTGCAACTAAAGGAACTAGG - Intronic
1194173376 X:90617401-90617423 ACTGTGGCATAAAGTGCACTGGG - Intergenic
1194311903 X:92320932-92320954 TCTTCGCCCCAAAGTGAACATGG - Intronic
1194605627 X:95974905-95974927 ACTTTGCAACAATTTGAACAGGG + Intergenic
1197671727 X:129284760-129284782 ACTTTGTCACAATTTGAACCAGG - Intergenic
1198223740 X:134626437-134626459 AAATTTCCACAAAATGAACTAGG - Intronic
1198801584 X:140453141-140453163 ACTGTACCACAAAGTACACTGGG + Intergenic
1200151996 X:153955730-153955752 ACTTTGCCTCAAAGGCAACTGGG + Intronic
1200519598 Y:4195117-4195139 ACTGTGGCATAAAGTGCACTGGG - Intergenic
1200620176 Y:5435058-5435080 TCTTCGCCCCAAAGTGAACATGG - Intronic