ID: 1130873458

View in Genome Browser
Species Human (GRCh38)
Location 15:87991373-87991395
Sequence TTTCTATGCAGAGTAAAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130873455_1130873458 20 Left 1130873455 15:87991330-87991352 CCTACCGGATTGGGATCTGCATT 0: 1
1: 0
2: 2
3: 12
4: 134
Right 1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG 0: 1
1: 0
2: 2
3: 41
4: 338
1130873456_1130873458 16 Left 1130873456 15:87991334-87991356 CCGGATTGGGATCTGCATTTTAA 0: 1
1: 0
2: 4
3: 27
4: 218
Right 1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG 0: 1
1: 0
2: 2
3: 41
4: 338
1130873451_1130873458 30 Left 1130873451 15:87991320-87991342 CCATCCAAAACCTACCGGATTGG 0: 1
1: 0
2: 1
3: 7
4: 52
Right 1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG 0: 1
1: 0
2: 2
3: 41
4: 338
1130873454_1130873458 26 Left 1130873454 15:87991324-87991346 CCAAAACCTACCGGATTGGGATC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG 0: 1
1: 0
2: 2
3: 41
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130873458 Original CRISPR TTTCTATGCAGAGTAAAATG TGG Intronic
902353548 1:15878600-15878622 ATTCTATGCAGAAAAAAAAGTGG - Intronic
904013382 1:27403059-27403081 TTTCTCTTCTGTGTAAAATGGGG + Intergenic
905655379 1:39683348-39683370 TTTCTCTGCAGAGTTCAAGGAGG - Intronic
906827442 1:48996770-48996792 TTTATAGCCAGAGGAAAATGTGG + Intronic
906869607 1:49463403-49463425 TTTCTATTCATAGTAAAATGTGG - Intronic
907544549 1:55248206-55248228 TTGCTATGCAGAGAAAAAGGGGG - Intergenic
907550176 1:55298528-55298550 TTTCTGTGCAGAGTAAGCAGGGG + Intergenic
907915000 1:58860574-58860596 TTTCTATCTTGAGTGAAATGAGG - Intergenic
908038843 1:60085533-60085555 TTTATATGCTGAGCACAATGAGG + Intergenic
908569706 1:65396346-65396368 TTTTCATGCTGAGTAAAATGGGG - Intronic
909491423 1:76231032-76231054 TTTCTATGGTGAATAAACTGTGG + Intronic
909913933 1:81294432-81294454 CTTCTGTGCAGTGTTAAATGGGG - Intergenic
910069496 1:83194689-83194711 TCACTATTCAGAGAAAAATGTGG + Intergenic
910571306 1:88707276-88707298 TTGCTGTACAGAGGAAAATGTGG + Intronic
910608439 1:89113129-89113151 TTTCTCTGCAGGGTTATATGAGG + Intronic
910614605 1:89183370-89183392 TTTGTATGCAGAGTAAGCTGGGG - Exonic
911661174 1:100503043-100503065 TTTCTAAGCAAAGTTAAAGGGGG - Intronic
911942447 1:104064828-104064850 GTTCTATGTAGAGTTAAAAGTGG - Intergenic
915154735 1:153865757-153865779 TTTCTCTAAAGAGCAAAATGTGG - Intronic
915308716 1:154996181-154996203 CTTTTATGCTGAGTGAAATGAGG + Intergenic
916839244 1:168583224-168583246 TTTCAATGCAGTGTAATATGTGG + Intergenic
916861612 1:168812029-168812051 TTCCTATGCAGAGTACCATTGGG + Intergenic
917393334 1:174563687-174563709 GTTGTTTTCAGAGTAAAATGGGG + Intronic
917762701 1:178180832-178180854 TTTGTATACAGAATAAATTGTGG - Intronic
918711092 1:187731311-187731333 CTTTTATGCTGAGTAAAATGGGG - Intergenic
919437538 1:197580631-197580653 TTTCTGTGCAGACTGACATGTGG + Intronic
920627401 1:207615963-207615985 GTTCTAAGCAGACTAAAAGGAGG + Intronic
921675946 1:217976627-217976649 GCTTTATGCTGAGTAAAATGGGG + Intergenic
922072951 1:222214589-222214611 TTTTTACGAAGAATAAAATGTGG - Intergenic
923503786 1:234588383-234588405 TTGCTATGCTGAATAAAATGTGG - Intergenic
923947783 1:238908875-238908897 TTTCTAAGCTGAGTAAGATCTGG + Intergenic
924516666 1:244771682-244771704 TTTCTATGGAGGGTAATGTGAGG + Intergenic
924853244 1:247852054-247852076 TCTCTATTCTGTGTAAAATGAGG - Intergenic
1062865836 10:853087-853109 TTTCCATGCAAATTAGAATGAGG - Intronic
1063136745 10:3223802-3223824 TTCTTGTGCAAAGTAAAATGTGG + Intergenic
1065069358 10:22005757-22005779 TTTCTATGCAGTAGAATATGGGG - Intergenic
1065792968 10:29278636-29278658 ATTCTATGCTGTGTAAAATATGG + Intergenic
1066150782 10:32614654-32614676 TTTTGATGGAGACTAAAATGTGG - Intronic
1067905689 10:50288352-50288374 TTTTTATAGAGAGAAAAATGGGG - Intergenic
1068162507 10:53283744-53283766 TTTATAAACAGAGAAAAATGCGG + Intergenic
1068415660 10:56718345-56718367 TTTTTATGCTGACTCAAATGTGG + Intergenic
1069100513 10:64314611-64314633 ATTCTATGCAGATTAGAAAGAGG - Intergenic
1069157446 10:65048728-65048750 TTTATATGCATTGTTAAATGAGG - Intergenic
1069187570 10:65444641-65444663 TTTCTATGCAGTTTCAAATGGGG - Intergenic
1074183541 10:111082784-111082806 ATACTATGCACAGGAAAATGTGG - Intergenic
1075830469 10:125406896-125406918 TCTCTATGCTGAGAAAAATAAGG - Intergenic
1076478315 10:130767698-130767720 TTTCCATGCAGAGCCAAATGTGG + Intergenic
1077759883 11:5083047-5083069 TCTCTATGCAGAGAGATATGGGG - Intergenic
1078598142 11:12706889-12706911 TTTCTCTTCAGTGTAAAATGGGG - Intronic
1079023678 11:16928782-16928804 TTTTTATGCACACTAAAATTAGG - Intronic
1079632435 11:22694367-22694389 TTTCCATTCACACTAAAATGAGG + Intronic
1080090395 11:28341559-28341581 TTTTTCAGAAGAGTAAAATGAGG - Intergenic
1080757584 11:35216895-35216917 TTTATATGCACATTAAAATTTGG + Intronic
1081619465 11:44610714-44610736 TTTCTCAGAAGAGAAAAATGAGG - Intronic
1081944555 11:46978527-46978549 TTTCTGTGTAGACTAAACTGGGG + Intronic
1084144368 11:67256278-67256300 GTTCAATGCAAAGTAAAAGGGGG - Exonic
1084480460 11:69416939-69416961 TTCCTTTGCACAATAAAATGAGG - Intergenic
1086521307 11:87671264-87671286 TTTATGTGCATAGTAACATGTGG + Intergenic
1086668698 11:89520016-89520038 TTACTATGAAGTGTAAAATGAGG + Intergenic
1087232170 11:95678635-95678657 TTTGTGTACAGACTAAAATGAGG - Intergenic
1088439934 11:109858952-109858974 TTTCTCTCAACAGTAAAATGGGG - Intergenic
1089231969 11:116985850-116985872 TTTCTATGTAGGGAAAAATGAGG - Intronic
1089697351 11:120224432-120224454 TTTCTCTGATGTGTAAAATGGGG - Intronic
1089868229 11:121650515-121650537 TTTCCATGCAGAATCACATGTGG + Intergenic
1090009162 11:123030667-123030689 TCTCAATGCAGAGGACAATGGGG - Intergenic
1090992848 11:131835979-131836001 TTTATATGGAGAGTAAAAATGGG + Intronic
1091346885 11:134860587-134860609 TTTCTATGCAGTGTGAAGTAAGG + Intergenic
1091704435 12:2684185-2684207 TTTCTATGCTGGGGAAAAGGAGG - Intronic
1091711009 12:2740535-2740557 TTTCTATGCTGGGGAAAAAGAGG - Intergenic
1092058868 12:5531700-5531722 TTTGTTTGCAGAGTCACATGTGG + Intergenic
1092652772 12:10652582-10652604 TTTCTATGCTGAATAACTTGAGG + Intronic
1092776916 12:11951887-11951909 TTTTTATTCTGTGTAAAATGAGG - Intergenic
1093622040 12:21303214-21303236 TCTCTATACATATTAAAATGAGG - Intronic
1093880795 12:24402076-24402098 TCTCACTTCAGAGTAAAATGAGG + Intergenic
1094119173 12:26951017-26951039 TTACTATGCATGGTAACATGAGG + Intronic
1095736015 12:45556979-45557001 TTTCTATCCTAAGTAAAATCAGG + Intergenic
1097141512 12:56906264-56906286 TGTATAGGAAGAGTAAAATGTGG + Intergenic
1097514115 12:60582148-60582170 CTTCTATGCAGATTAAAGAGAGG - Intergenic
1099869487 12:88328674-88328696 TTTCTATGCTGGATAAAAAGAGG - Intergenic
1101180773 12:102214977-102214999 TTTCTATGCAAAGAGAAGTGTGG + Intergenic
1101234783 12:102777365-102777387 TTTATATGCTGATAAAAATGAGG - Intergenic
1103214499 12:119191191-119191213 TTTCTTTGCAGAAAAAAAGGGGG - Intronic
1103854918 12:123960401-123960423 TTTCTGTGGAAAGGAAAATGTGG + Intronic
1104091052 12:125518077-125518099 ATTCTATGTGGAGTACAATGTGG + Intronic
1104122442 12:125812286-125812308 TTTTTACTCAGAGTAAAATGGGG - Intergenic
1104616981 12:130278881-130278903 TTTTAATGCAGAGCAAAATTAGG + Intergenic
1104827058 12:131719443-131719465 TTTTTATGCAGAAAAAAATGAGG + Exonic
1106741381 13:32646830-32646852 TTTAAGTGCAGAGTAAAATAAGG - Intronic
1106963457 13:35030340-35030362 GCTCTATGAAGAGTAAAATGAGG - Intronic
1106971767 13:35149231-35149253 TCCCTATGCAGAGTATAATGAGG + Intronic
1107246559 13:38303513-38303535 ATTGTATGGAGAGTAAAAAGGGG - Intergenic
1107530711 13:41279903-41279925 TTTCTCTGCAAAGTAAAATTTGG + Intergenic
1108076716 13:46687654-46687676 TTTCTATTCAAAGTAGAATTTGG + Intronic
1108116512 13:47134767-47134789 GTTTTATCCAGTGTAAAATGTGG + Intergenic
1108259101 13:48639234-48639256 TTACTATGATGAGTAAAATTGGG + Intergenic
1108693752 13:52884313-52884335 TTTCTCTGGAGGGAAAAATGTGG + Intergenic
1109131791 13:58596148-58596170 TTTCTCTGCAAAGTTCAATGAGG - Intergenic
1110773271 13:79376032-79376054 TTTCGCAGCTGAGTAAAATGAGG + Intronic
1110997678 13:82134167-82134189 TTTCTATACAGTGAAAAATAGGG - Intergenic
1111091093 13:83448790-83448812 TTTCTATGTTGAGTAAAAGTAGG - Intergenic
1112173472 13:96997169-96997191 TTTCTATGCAGAGTTCCACGGGG - Intergenic
1113630306 13:111877955-111877977 TTTTTATGGAGAGTAAAAAAGGG + Intergenic
1114163951 14:20199599-20199621 TTTCTATCAACAGTAAAATCTGG - Intergenic
1114363284 14:21999721-21999743 TTTCTATTCACAGCAAAATTTGG + Intergenic
1114864766 14:26575950-26575972 TTTTTATGGAGACTAAAATGAGG + Intronic
1115658185 14:35464304-35464326 TTTCAATTCATAGTAAAAAGGGG + Intergenic
1118472574 14:66088735-66088757 TTTCTATAGAGAGCAAAGTGGGG - Intergenic
1119012372 14:71006825-71006847 TTTATCTTCAGAGTAAAATTTGG + Intronic
1120523062 14:85547249-85547271 CTACTATGCAGATAAAAATGGGG - Intronic
1124862255 15:33453717-33453739 TTTCTATGGAAAGAAAAATAAGG + Intronic
1124952378 15:34336144-34336166 TTTCTAAGAAGACAAAAATGAGG + Intronic
1125366957 15:38927634-38927656 TTTTTGTGCATAGTAGAATGAGG + Intergenic
1125418573 15:39478835-39478857 TTACAGTGCAGAGTACAATGGGG + Intergenic
1126358026 15:47816872-47816894 TTGCTTTGCTCAGTAAAATGTGG - Intergenic
1126580244 15:50236410-50236432 TTTGTATTTAGAGTAAAGTGAGG - Intergenic
1126665499 15:51072867-51072889 TTTCTAAGCAGAATAAAGTGAGG - Intronic
1128034529 15:64512350-64512372 TTTCTATGTAGATTAGAAAGGGG + Intronic
1128717942 15:69922417-69922439 TTTCGGGGCAGAGTAAAAAGGGG + Intergenic
1129196387 15:73969725-73969747 GTTCTAAGCAGAGGAACATGAGG - Intergenic
1130718191 15:86357533-86357555 TTTCTATGTAGGGTAAAAAAGGG + Intronic
1130873458 15:87991373-87991395 TTTCTATGCAGAGTAAAATGTGG + Intronic
1131548729 15:93338229-93338251 TTGCTCTGCTGAGTAAACTGAGG - Intergenic
1131814909 15:96212093-96212115 TTTCTAGGCACAAGAAAATGAGG - Intergenic
1132002767 15:98196703-98196725 GCACTATGCAGAGTAATATGTGG - Intergenic
1132219606 15:100095513-100095535 CTTCTATGCAGAGCAACTTGTGG + Intronic
1133074217 16:3267501-3267523 TTTCTATCAACTGTAAAATGGGG + Intronic
1135207785 16:20497442-20497464 TTTGTAAGGAGAGTAAAATGTGG + Intergenic
1135211114 16:20526258-20526280 TTTGTAAGGAGAGTAAAATGTGG - Intergenic
1135882567 16:26272744-26272766 TTTGTATACAGAGTAGAATTTGG - Intergenic
1135988616 16:27203346-27203368 TATCTGTGCAGAGGAAAAAGCGG + Intergenic
1137301936 16:47157962-47157984 TTTTTATGCAAAGAAAAAAGAGG - Intronic
1137891587 16:52168621-52168643 TGTCTATACAAAGTAAAATTAGG + Intergenic
1137960270 16:52875874-52875896 TTTCTATATAGGGTAAAATTTGG + Intergenic
1140661893 16:77196473-77196495 TTACTATAAAGAGTAACATGGGG + Intronic
1141232146 16:82178445-82178467 TTTCTCTGCTGAGTAACATTTGG + Intergenic
1142164181 16:88576961-88576983 TTTCTCTGCAGAGTGGAGTGTGG + Intronic
1146763709 17:35500012-35500034 TTTCCATCCAAAGTAACATGAGG - Intronic
1147473372 17:40685554-40685576 TTGCTTTGCAGAAAAAAATGAGG + Intergenic
1148575783 17:48710046-48710068 TTTCTCTGAAGAGTAAGCTGTGG - Intergenic
1148706936 17:49642736-49642758 TTTCTCTGTAGCATAAAATGTGG + Intronic
1150363199 17:64556553-64556575 TCTCTATGAGGAGTAAAATGAGG + Intronic
1150514490 17:65793909-65793931 TAGCTATGGAGAGTAGAATGGGG - Intronic
1150965229 17:69960457-69960479 TTTATATCCATAGGAAAATGAGG - Intergenic
1151281170 17:73075299-73075321 TTTCTCAGCAGAGTCAACTGAGG + Intronic
1151550310 17:74818917-74818939 CTTCTTTGCAAAGGAAAATGGGG - Intronic
1152539247 17:80966722-80966744 TTTCAATGCAGACTTGAATGGGG - Intergenic
1153071358 18:1108782-1108804 TTTCCATGCTGAGTAATATATGG - Intergenic
1153269667 18:3307725-3307747 CTTCTATTCAAAATAAAATGTGG + Intergenic
1153484667 18:5584592-5584614 ATTCTTTGTAGAATAAAATGAGG + Intronic
1153579686 18:6560377-6560399 TTAATATTCAGAGTGAAATGTGG + Intronic
1156687282 18:39665823-39665845 ATTCCATGCAGAGTGAGATGAGG + Intergenic
1157233787 18:45943973-45943995 TTTCTCTTAAGTGTAAAATGTGG - Intronic
1158013046 18:52750682-52750704 TTTCTCTTCACTGTAAAATGGGG + Intronic
1158015843 18:52782835-52782857 TTTATACGAAGAGTATAATGGGG - Intronic
1158505178 18:58041243-58041265 TTTCTATGTATAGCAAAATTTGG + Intergenic
1158882902 18:61798221-61798243 TTTCTATTCAGAGTTAAATCTGG + Intergenic
1159759873 18:72411070-72411092 TTTATATCTAGATTAAAATGTGG + Intergenic
1160796076 19:946032-946054 TTTCTCAGCAGGGAAAAATGAGG + Intronic
1162285168 19:9733185-9733207 TTTCTTTGGGGATTAAAATGAGG - Intergenic
1164698598 19:30265537-30265559 TTTCTGTGCAGAGGGAGATGCGG - Intronic
1166649984 19:44565728-44565750 TTTTCATGCAGAGGAAAAGGAGG - Intergenic
926649510 2:15326965-15326987 TTCCTATGTAAAGTAAAATTTGG - Intronic
929010535 2:37438741-37438763 TTTCTGTACAGAGTAAGATATGG - Intergenic
929310022 2:40412787-40412809 TTTTCATCCATAGTAAAATGAGG - Intronic
930307079 2:49687972-49687994 TTTCTCTGCACTGTATAATGTGG - Intergenic
930616042 2:53594824-53594846 TTTCTATGCATTGGAAAATTGGG - Intronic
931793370 2:65686082-65686104 TTCCTATGCAAAATAAAATGTGG + Intergenic
931988693 2:67767445-67767467 TCTCAATGCAGAGGATAATGGGG - Intergenic
932021383 2:68090889-68090911 TTTCTATGCAGCTCAACATGGGG + Intronic
933184788 2:79267124-79267146 CTTCTGTGCAGAGAAATATGAGG - Intronic
934687471 2:96332386-96332408 TCTCCATGAAGAGTAAAATGGGG + Intergenic
935431503 2:102980833-102980855 TTTCTATGCTGATAAAAATTGGG - Intergenic
936002364 2:108845869-108845891 TATCTATTAAGAATAAAATGAGG - Intronic
936714965 2:115175549-115175571 CTTCTGTGCAGTGTAAAAAGGGG + Intronic
937853140 2:126653928-126653950 TTTCCAGGCTGAGAAAAATGAGG + Intergenic
940140980 2:150490306-150490328 TTTCTATGAAGAAAAACATGGGG - Intronic
940369094 2:152880379-152880401 TCTTCATGCAGTGTAAAATGAGG - Intergenic
940797479 2:158095819-158095841 TTTCTATTCTGAGTTGAATGTGG + Intronic
941693811 2:168529427-168529449 GTTATATGCAGAGTTTAATGAGG - Intronic
943290260 2:186062140-186062162 TTCCTGTGTAGAGTACAATGAGG + Intergenic
943334150 2:186593240-186593262 TTTCTATAAAGAGAAAAATTAGG - Intronic
943898242 2:193396788-193396810 AGTCTATGCAGAGGAAAATGGGG + Intergenic
944467853 2:200021660-200021682 TTGCTTTGCATAGTAACATGGGG + Intergenic
944672563 2:202007268-202007290 TGGCTATACAGAGAAAAATGAGG + Intergenic
944957676 2:204831181-204831203 TTTCTATGAATAGAAAAATTAGG + Intronic
945412828 2:209532734-209532756 TTTCTGTGCAGAGGAACAGGAGG - Intronic
945688305 2:213000041-213000063 TATCACTGCAGACTAAAATGTGG - Intronic
945689423 2:213014502-213014524 TGTCTATGCACAGTAAACTGTGG + Intronic
946115461 2:217458086-217458108 TGTCTATGCAGAGAAAAACCTGG + Intronic
946312546 2:218890798-218890820 TTTCTGTGCAGTCTAGAATGAGG + Intronic
946827879 2:223697320-223697342 TTACAATGCTAAGTAAAATGTGG - Intergenic
1169542500 20:6615309-6615331 TTTTTCTGAAGAGTAAACTGAGG - Intergenic
1169656952 20:7934987-7935009 TTTCTCTGCAAAAGAAAATGGGG - Intronic
1169735789 20:8836188-8836210 TTGCTTTGGACAGTAAAATGTGG - Intronic
1170998711 20:21391939-21391961 TTTCTAAGCATAGCAAAATTCGG - Intergenic
1173396585 20:42686128-42686150 TCACTATGGAGAGAAAAATGAGG - Intronic
1173682606 20:44896377-44896399 CTTGTATGCAGAGTAAATTTGGG + Intronic
1174620969 20:51874368-51874390 GTTCTGTGCAGTGTAGAATGTGG - Intergenic
1177407445 21:20688811-20688833 TTGTTATGCATAGTAAAATTTGG + Intergenic
1178021464 21:28413360-28413382 TCTCTCTTCAGAATAAAATGTGG - Intergenic
1178199300 21:30385555-30385577 TTTCTTTGGAGACTTAAATGAGG - Intronic
1178673657 21:34613960-34613982 TTATTGTGCAGAATAAAATGTGG - Intronic
1178812039 21:35893258-35893280 TTTCCATGCAGAGGAAGAGGTGG - Intronic
1179427362 21:41292330-41292352 ATTATATGCAAATTAAAATGTGG + Intergenic
1182008276 22:26979459-26979481 TCCCTATGTAGAGTATAATGAGG + Intergenic
1182828727 22:33287343-33287365 TATCTATGCAGAGGGAAATAAGG - Intronic
1182891761 22:33825127-33825149 ATTCTCTGCAGAGCAAACTGGGG - Intronic
949635663 3:5979030-5979052 GATCTATGCAGAGTAAAAACAGG - Intergenic
949702108 3:6770443-6770465 TTTCTGTGAAAACTAAAATGAGG + Intronic
949706500 3:6824115-6824137 TTTTTATGCAGAGTGAAATGAGG + Intronic
949762036 3:7481557-7481579 TTTCTCAGCAGAGGAAACTGAGG - Intronic
950916067 3:16646531-16646553 CTTTTATTCAGAGAAAAATGGGG + Intronic
950963832 3:17132245-17132267 GTTTTCTGCAGAGGAAAATGGGG - Intergenic
951541203 3:23783593-23783615 TTTCTATGCATTAAAAAATGTGG - Intergenic
951567710 3:24028098-24028120 AATCTATGAAGATTAAAATGAGG - Intergenic
951612538 3:24507370-24507392 TCTCTAAGCCGAATAAAATGTGG + Intergenic
953000574 3:38929211-38929233 TGTCAGTTCAGAGTAAAATGTGG + Intronic
953850235 3:46460426-46460448 TTTCTGTGCAGAGTGAATGGTGG - Intronic
955883817 3:63576474-63576496 TTTCTATGCATGGAAAACTGTGG - Intronic
955955522 3:64285592-64285614 TTCCTATGCACATTAAAATTTGG - Intronic
956156465 3:66303567-66303589 TTTCAATGGAGTGAAAAATGTGG - Intronic
956621024 3:71221635-71221657 TTTATATATAGACTAAAATGCGG - Intronic
957698326 3:83674198-83674220 TTTTAATGCAGTATAAAATGTGG - Intergenic
957781986 3:84831171-84831193 TTTCTATGCAATGTAGTATGTGG - Intergenic
957821600 3:85383612-85383634 TTCCAATGGAGAGAAAAATGAGG - Intronic
958642734 3:96828627-96828649 TTTCTGGCCAGATTAAAATGGGG + Intronic
958707137 3:97670009-97670031 ATTCTAGGCATATTAAAATGTGG + Intronic
959804510 3:110535024-110535046 TTTCTATGAAGAATATAATTGGG - Intergenic
959835122 3:110909483-110909505 TTTGCATGCACAGTAAAATGTGG + Intergenic
959837545 3:110938003-110938025 TGTCTAGGCAAAGTAAAAGGGGG + Intergenic
962864362 3:139435051-139435073 TGTCTCTGCAGCGGAAAATGAGG + Intergenic
962868194 3:139465387-139465409 TTTATTTGAAGAATAAAATGAGG - Intronic
962950420 3:140213506-140213528 ATTCTTAGCAGAGTAAAGTGAGG + Intronic
963348842 3:144128479-144128501 TTTCTATGCTGGGTGAAGTGAGG + Intergenic
963638860 3:147834578-147834600 TTTTTGTACATAGTAAAATGTGG + Intergenic
963765641 3:149333377-149333399 GTTCTAAGCAGGGCAAAATGGGG - Exonic
964022562 3:152031525-152031547 CTCTTATGCACAGTAAAATGTGG + Intergenic
965537342 3:169836941-169836963 CTTCTATTCAGAGAGAAATGGGG + Intronic
965725254 3:171709041-171709063 TCTCTAAGCAGAGAAAAATCAGG - Intronic
966846458 3:184134484-184134506 TTTCTGGGCAGAGGAAAGTGCGG - Intergenic
967119042 3:186366282-186366304 TTTCTAAGAAAACTAAAATGAGG - Intergenic
969208002 4:5663410-5663432 TTTCTTTGCAGAGAAAACAGAGG - Intronic
970072105 4:12171979-12172001 ATTTTAAGTAGAGTAAAATGTGG + Intergenic
970731026 4:19103657-19103679 TTTTGATAGAGAGTAAAATGAGG - Intergenic
970965185 4:21919771-21919793 TTTCTATACTTAGAAAAATGTGG + Intronic
971065653 4:23029450-23029472 AATGTCTGCAGAGTAAAATGTGG - Intergenic
971734543 4:30429564-30429586 TTTTTATTCAGATTAAAATAAGG + Intergenic
971818436 4:31520527-31520549 TTTCTATGCAAATGAGAATGTGG - Intergenic
971965626 4:33551793-33551815 TTTATATGGAGAGTAAAGTATGG + Intergenic
972932559 4:44091426-44091448 TTTCTGTGAACTGTAAAATGAGG - Intergenic
973136498 4:46714379-46714401 TTTGTATACAGTGTAAAATGAGG + Intergenic
974502347 4:62723114-62723136 ATTATATGAAGAGTAGAATGTGG + Intergenic
975250928 4:72176888-72176910 TTCCTCTGCACAATAAAATGTGG + Intergenic
976458272 4:85276260-85276282 ATTCTATGGAGACTGAAATGGGG + Intergenic
977086898 4:92611392-92611414 TTTCTATGCAGAGAAATCAGAGG - Intronic
977556956 4:98496514-98496536 TTTTTTTGCAGATTAAAAAGTGG + Intronic
977802066 4:101246624-101246646 TTTATACTCAGAGTAATATGTGG - Intronic
978103105 4:104867379-104867401 TTTCTATGCATTTTAAAGTGAGG - Intergenic
978103601 4:104873953-104873975 TTTCTAAGCAGAGTAAATGACGG - Intergenic
978627063 4:110698558-110698580 TTTCTATGTGGTGTAAAATAAGG + Intergenic
979047996 4:115894231-115894253 TTTATATACAGAGAAATATGGGG + Intergenic
979637401 4:122973307-122973329 CTTGTATGCAGGGTAAATTGGGG + Intronic
980005761 4:127540718-127540740 TTGTTATGCAGATTTAAATGAGG - Intergenic
980796768 4:137695596-137695618 GTTCTATGCTAAGTAAAAAGGGG + Intergenic
981677105 4:147354880-147354902 TTTCAATCCAGAGAAGAATGGGG - Intergenic
981736355 4:147956399-147956421 TTTATATGTAGAGTCTAATGGGG - Intronic
981811103 4:148775799-148775821 TTTCTTTGCAGGTTGAAATGTGG + Intergenic
981892350 4:149753443-149753465 TTGATATACAGAATAAAATGTGG + Intergenic
982891724 4:160862032-160862054 TTTCAATGCATAGAAAAGTGTGG - Intergenic
983823605 4:172229103-172229125 TTTTTCTGCCGAGTAAACTGAGG - Intronic
984624780 4:181994986-181995008 TTTCTAAGAAAAGTAGAATGAGG + Intergenic
986457133 5:7930938-7930960 TTTCTTTGCAGAGAAAGAGGAGG - Intergenic
986981399 5:13451670-13451692 TTTCTATGTAGAACTAAATGAGG - Intergenic
987434558 5:17878532-17878554 TTTCCATCCAAAGTAAAATGTGG - Intergenic
987815218 5:22891634-22891656 ATTCTATGTAGAACAAAATGAGG - Intergenic
988669793 5:33369148-33369170 CTTCAATGCACAATAAAATGAGG + Intergenic
989737592 5:44727480-44727502 TTTCTACCCAGAGGACAATGAGG - Intergenic
990245046 5:53856247-53856269 TTTCATTGAAGAGTAAAATCTGG + Intergenic
992579713 5:78159120-78159142 TTACTATGCAAAGCAAAATTTGG + Intronic
993211144 5:84952808-84952830 TTTTTTTTCACAGTAAAATGAGG - Intergenic
994732782 5:103513557-103513579 TTTCCATGCAAAGTAATATTTGG + Intergenic
996907958 5:128623332-128623354 ATTTGATGCAGACTAAAATGAGG + Intronic
998351653 5:141505825-141505847 TTTCTAGGCTGAGGAAACTGAGG - Intronic
998839932 5:146242450-146242472 CTGCTATGCAGAGAAATATGTGG + Intronic
999298837 5:150477849-150477871 TTTCCAGGCAGAGAAAAAGGTGG + Intergenic
999305198 5:150515078-150515100 GGTCTGTGCAGAGTAAACTGGGG - Intronic
999772313 5:154784962-154784984 TTTCTGTTCTGAGTAAAAAGTGG + Intronic
1000026722 5:157365042-157365064 TTTCAATGCAGAGTTATTTGTGG - Intronic
1000106334 5:158062657-158062679 TGTCTATGTAGCATAAAATGAGG + Intergenic
1001755902 5:174168363-174168385 TTTCTCAGCAGAAAAAAATGAGG - Intronic
1002559005 5:180068071-180068093 TTTCTATGCAAAGCAAGAAGTGG + Intronic
1003275664 6:4648546-4648568 CATATATGCAGAGAAAAATGTGG - Intergenic
1004048124 6:12046341-12046363 TTTTTTTGCAGGGTTAAATGTGG - Intronic
1004669875 6:17785637-17785659 TTTCTCTGCAGAAAAAAATGAGG + Exonic
1006199420 6:32274305-32274327 TTTCTATACAGAGAAGAATTGGG - Intergenic
1006743089 6:36323141-36323163 TTTCCATGCTGAGTAGAGTGGGG - Intronic
1008259244 6:49344397-49344419 TTTCTCTGCAGAGTAAATACAGG + Intergenic
1008334345 6:50282539-50282561 TTTATATACACAATAAAATGAGG - Intergenic
1008711957 6:54238030-54238052 TTTAAATGCATTGTAAAATGGGG - Intronic
1009290511 6:61875236-61875258 ATTCCATGCAGAGTAAAATCAGG + Intronic
1009571757 6:65394131-65394153 TTACTATTTAGAGTAAAATGAGG - Intronic
1010339285 6:74729224-74729246 TTTCTATGCTTAGAAAAATGGGG - Intergenic
1010488835 6:76450604-76450626 TTTCTATCCAGTGGAAAATGTGG - Intergenic
1010521248 6:76840631-76840653 TTTATATGCAGTGTCAACTGGGG - Intergenic
1012309531 6:97705238-97705260 TATCTATGCATAGAAAAATATGG - Intergenic
1014226125 6:118849080-118849102 TTTGTATGCAGCGTAGAATTGGG - Intronic
1015756727 6:136614652-136614674 TTAATATGGAGAGTAAACTGTGG - Intronic
1015839600 6:137462484-137462506 TTTATAGGCAGTGTAAAGTGGGG - Intergenic
1016189513 6:141246401-141246423 TTTCTATAGAGAGTTAAAAGAGG + Intergenic
1016780024 6:147947117-147947139 ATTCTATGCAGAGCAAAAGATGG - Intergenic
1016946985 6:149544610-149544632 TTTCTAAGCAGAGTTACCTGAGG - Intronic
1019107334 6:169678980-169679002 TTACTCTGCAGAGTAAAACATGG + Intronic
1020483166 7:8687490-8687512 TTTCTATGATTAGAAAAATGAGG - Intronic
1020688197 7:11322189-11322211 TTTTTATAAAGAGTAATATGTGG - Intergenic
1021330101 7:19326337-19326359 TTTGTATGCACTGTAAAACGAGG + Intergenic
1021385905 7:20029678-20029700 ATTCAAAGCAGAGTAAAAAGAGG - Intergenic
1022175682 7:27869816-27869838 TTTCTGTGCAAAGTAAAGGGAGG + Intronic
1022342662 7:29483370-29483392 TGTCTAAGCAAAGTAAAATTCGG + Intronic
1023321505 7:39002855-39002877 TTTCTATGCAGAGGACATTTTGG - Intronic
1024464463 7:49697093-49697115 TTTGAATGGAGAGTAAAGTGAGG - Intergenic
1024565189 7:50674647-50674669 TTTCTGTGCAGAGGATGATGTGG - Exonic
1024710376 7:52008860-52008882 TTTCTATGCAGAAAAACAGGAGG + Intergenic
1025770461 7:64500558-64500580 TTTCTATGTAGAGTATAAAAAGG + Intergenic
1026375650 7:69747929-69747951 TTTCTTTGCTGAGTAGAATATGG + Intronic
1027287277 7:76659871-76659893 TCACTATTCAGAGAAAAATGTGG + Intergenic
1027981648 7:85231878-85231900 GTTTTAGGCAGAGTAAAAAGAGG + Intergenic
1028323559 7:89493554-89493576 TTTCTATGCTGAAGAAAATCAGG - Intergenic
1030652438 7:112130042-112130064 TTTCCAGGCAGAGTTAAAAGTGG - Intronic
1031288631 7:119904322-119904344 TTTATATGAAGAGTACAATCAGG - Intergenic
1031677437 7:124628069-124628091 TCACAATGAAGAGTAAAATGAGG + Intergenic
1032576116 7:133056842-133056864 TTTTTCTTCAGAATAAAATGGGG - Intronic
1033990720 7:147282765-147282787 TTTATATGTAGAGAAAGATGGGG + Intronic
1034018672 7:147615832-147615854 TTTCAATGTTAAGTAAAATGAGG - Intronic
1036976325 8:13417147-13417169 TTTTTAGGAAGAGAAAAATGAGG + Intronic
1037406696 8:18549936-18549958 TTTCTATGACGAGGAAACTGAGG + Intronic
1037483584 8:19327095-19327117 TTTCTCTGCAGAATGAAGTGTGG + Intronic
1039211572 8:35221221-35221243 TTTATAAGCATAGAAAAATGTGG - Intergenic
1039254024 8:35699088-35699110 TGAATATGCAGAGTAAAATATGG - Intronic
1040589662 8:48778786-48778808 AATCTATGCACAGTCAAATGAGG - Intergenic
1040993778 8:53380040-53380062 TTTCTATGTAGAGTAAGATAGGG + Intergenic
1041291694 8:56314233-56314255 TTTCTATCCAGAATAAAAAGTGG + Intronic
1041828468 8:62125151-62125173 ATTCTAAGCAGAGTAAAGTCTGG + Intergenic
1044906677 8:97011695-97011717 TTGCTTTGCAGAATTAAATGAGG + Intronic
1044977780 8:97682927-97682949 TTTGTATTTAGAGTTAAATGTGG + Intronic
1045538291 8:103056308-103056330 TTCCTTTGCCAAGTAAAATGAGG - Intronic
1046190058 8:110782998-110783020 TTTGTAAGTAGAGTAAAATAGGG + Intergenic
1047518223 8:125573872-125573894 TTTCTTGGAAGAGTCAAATGAGG + Intergenic
1047851672 8:128864010-128864032 TTTCTATGCAGAGTAATTTAAGG + Intergenic
1048898814 8:139018615-139018637 TATCTATGAAGAGGAAACTGAGG + Intergenic
1048972996 8:139655620-139655642 TTTCTCAGCTGAGTAAACTGAGG + Intronic
1049109466 8:140634576-140634598 TTTAAATGCAGAGTAGAAGGCGG - Intronic
1049262525 8:141647098-141647120 TTCCTGTGCAGAGAAGAATGTGG - Intergenic
1050208325 9:3223285-3223307 TTTTCATGCAAATTAAAATGGGG + Exonic
1050222155 9:3404773-3404795 CTTCGATGGAGACTAAAATGGGG + Intronic
1050797587 9:9563453-9563475 TGTCCATGCAGAATAAAATAAGG - Intronic
1052351353 9:27461508-27461530 TATCTTTGAAGATTAAAATGAGG - Intronic
1055016186 9:71620670-71620692 TGTCTCTGCAGAGTAAATTGTGG - Intergenic
1057942646 9:99298349-99298371 TTGCTAAGCAGAGGAATATGGGG + Intergenic
1058286416 9:103185418-103185440 TTTTTATTCAGAGAGAAATGTGG - Intergenic
1058312734 9:103525510-103525532 TTTCTATGAAGCGTAAAATTTGG + Intergenic
1058414596 9:104774383-104774405 TTTCCATGCAGAGTTCAAAGAGG + Intronic
1059105556 9:111508301-111508323 TTTCTGTGCAGAAACAAATGTGG + Intergenic
1059287832 9:113191573-113191595 GTGATATGCAGATTAAAATGAGG + Intronic
1059504833 9:114789014-114789036 TTTATATGCAGAGTATTATGTGG - Exonic
1060418163 9:123447607-123447629 TTGCTATGCAGAGTTAGAGGAGG + Intronic
1186700945 X:12089298-12089320 TTTCTATGGAGAGTAAACCAAGG + Intergenic
1187396003 X:18920190-18920212 CTTCTTGGCAGAGTAAAATTAGG - Exonic
1187515949 X:19970287-19970309 TTTCTTTGCAGTGTAAAAAGTGG - Exonic
1188122486 X:26326173-26326195 TTTCTATGGAGTGTAAAGGGTGG + Intergenic
1188278354 X:28230783-28230805 TTTCTATGTAAAATGAAATGAGG - Intergenic
1189119705 X:38381187-38381209 TTCCCATGCAAAGCAAAATGAGG - Intronic
1190006357 X:46743157-46743179 TTTTCCTGCAGAGTAATATGTGG - Intronic
1190483735 X:50903604-50903626 CTGCTATTCAGAGTAAACTGCGG + Intergenic
1191821485 X:65313762-65313784 TTTCTATGCAAAGTAATTTTGGG - Intergenic
1192449798 X:71236964-71236986 TTTGTATTCATAGTAACATGAGG + Intergenic
1193307301 X:79964219-79964241 TTTCTCTGCAAGGGAAAATGTGG - Intergenic
1193574296 X:83180530-83180552 TGTGTAAGAAGAGTAAAATGTGG - Intergenic
1195824213 X:108979932-108979954 TTTCTAAGCAGATTAAATTAAGG + Intergenic
1197295586 X:124715457-124715479 TTTCTCTGTTGAGTAAAATTGGG - Intronic
1198124927 X:133633973-133633995 TTTCAATGGAGAGAAAAAAGTGG - Intronic
1198973232 X:142304662-142304684 TTTATATGAAGATTAAAAGGGGG + Intergenic
1201926085 Y:19289410-19289432 GTTCTATGAAGATAAAAATGGGG + Intergenic