ID: 1130874962

View in Genome Browser
Species Human (GRCh38)
Location 15:88005802-88005824
Sequence AAGGGTAAAAACTTTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130874962_1130874968 22 Left 1130874962 15:88005802-88005824 CCTTCAACAAAGTTTTTACCCTT 0: 1
1: 0
2: 0
3: 11
4: 222
Right 1130874968 15:88005847-88005869 GAGATAGGGCAATACATTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 151
1130874962_1130874965 7 Left 1130874962 15:88005802-88005824 CCTTCAACAAAGTTTTTACCCTT 0: 1
1: 0
2: 0
3: 11
4: 222
Right 1130874965 15:88005832-88005854 ATTAGCAACCTATCAGAGATAGG 0: 1
1: 0
2: 1
3: 8
4: 101
1130874962_1130874966 8 Left 1130874962 15:88005802-88005824 CCTTCAACAAAGTTTTTACCCTT 0: 1
1: 0
2: 0
3: 11
4: 222
Right 1130874966 15:88005833-88005855 TTAGCAACCTATCAGAGATAGGG 0: 1
1: 0
2: 2
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130874962 Original CRISPR AAGGGTAAAAACTTTGTTGA AGG (reversed) Intronic
904070829 1:27795749-27795771 AAGGGTAACTACTTTGTAGCAGG - Intronic
908147776 1:61265789-61265811 AAAGGAAAAAACTTAGTTTATGG + Intronic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
909733456 1:78925979-78926001 AATGGTAAGCACTATGTTGAGGG - Intronic
911034263 1:93522807-93522829 AAGGGTAAAAACGTGTGTGAGGG - Intronic
912125518 1:106532674-106532696 AAGGGAAATAACCTTGCTGAGGG + Intergenic
913502714 1:119486347-119486369 AAGGTTAAAAAATTTTTTGGAGG - Intergenic
914445489 1:147747172-147747194 AAGGGTAGAAACTTTATTTTTGG + Intergenic
918173385 1:182020997-182021019 AAGAGCAAAAACTTGGTGGAAGG - Intergenic
918415910 1:184308717-184308739 AAGGGTAAAAGGTTTATTCAAGG - Intergenic
919541439 1:198850592-198850614 GAGGGTATAAACTTTGTTCTTGG + Intergenic
919720752 1:200832250-200832272 ATTGGTAGAAAATTTGTTGAAGG + Exonic
920294255 1:204946316-204946338 AAGGATAACACCTATGTTGAGGG - Intronic
921862372 1:220053340-220053362 AAGGGTACAAAGTTTCTTTAGGG - Intergenic
922579844 1:226688726-226688748 AAGGGTACAAAGATTGTTGGTGG - Intronic
924532612 1:244906011-244906033 AAGGGTAAGAACATTTTTTAAGG + Intergenic
924735432 1:246751439-246751461 AAGGTTAAAAATTGTTTTGAAGG - Intronic
1066070853 10:31809699-31809721 TATTGTAAAAACTTTATTGAAGG + Intronic
1066546256 10:36503720-36503742 AAGGGTTGTAACTTTGTAGAAGG + Intergenic
1069488899 10:68844637-68844659 AAGGAAAAAAACTTTTTTCATGG - Intronic
1069521698 10:69126625-69126647 AAGAGAATAAAATTTGTTGAGGG - Intronic
1071274685 10:84042597-84042619 CATGGTAAAAGCTTTGGTGATGG + Intergenic
1071962949 10:90824275-90824297 AAGGGAAAACACTGTCTTGAAGG + Intronic
1074121069 10:110494955-110494977 AAGGTTAAAAACTATGGTGTTGG + Intergenic
1074502388 10:114038229-114038251 AAGGGGAAAAACTTTTGTAAAGG + Intergenic
1076030585 10:127154479-127154501 AAAAGTAAAAACTTTATTCATGG - Intronic
1076176967 10:128375558-128375580 AAGTGTTAAAACGTGGTTGAAGG + Intergenic
1076413852 10:130271070-130271092 AAGCGTAAACACTCTCTTGAGGG + Intergenic
1078297224 11:10084955-10084977 CATGGTAAAAAATTTGTTAATGG + Intronic
1082801869 11:57420806-57420828 GAGGTTAAAAAGCTTGTTGAAGG - Intronic
1085607417 11:77914471-77914493 AAAACTAAACACTTTGTTGAGGG + Intronic
1086259877 11:84926258-84926280 ATTGGTAAAAACTTTTTGGAAGG + Intronic
1087963642 11:104384903-104384925 AAAGTTAAATACTTTGTTCAAGG - Intergenic
1088782021 11:113144705-113144727 AAGTCTAAAAAGTTTGTTAAAGG - Intronic
1089447945 11:118568639-118568661 ATGGGTACAAACTTTCTTTAGGG - Intronic
1089491788 11:118888480-118888502 AAGGATGACCACTTTGTTGAGGG - Intronic
1089734386 11:120539630-120539652 AATGGCAATAACTTTGCTGATGG - Intronic
1089761354 11:120726432-120726454 CAGGGTAAAAGCAGTGTTGATGG + Intronic
1090420170 11:126569345-126569367 GAGGGTAAACATTTTGTTGGGGG + Intronic
1090452667 11:126820540-126820562 GAGGTAAAAAATTTTGTTGAAGG + Intronic
1090453139 11:126824065-126824087 AAGGGAAAACAATTTGTTCAGGG - Intronic
1090591222 11:128271784-128271806 AATGGGATAAACTTTGTAGATGG - Intergenic
1093395017 12:18670494-18670516 GAGGTTAAGAACTGTGTTGAAGG - Intergenic
1093728506 12:22542750-22542772 AAGGGTAAATAATTTGCTTAAGG - Intronic
1095306726 12:40647237-40647259 AAAGGTATGAAATTTGTTGAAGG - Intergenic
1095821340 12:46482016-46482038 AAGGGGAAAAAATTGGTTTAGGG - Intergenic
1096744705 12:53718454-53718476 AAGATTAAAAACTTTATTGGTGG + Intronic
1097487805 12:60227894-60227916 ATGGGTACCAACTTTTTTGAAGG + Intergenic
1097870075 12:64594414-64594436 AAGATTAAAAACTTTATTGGTGG - Intergenic
1098137497 12:67417904-67417926 CAGTGTAGAAACTTTGTTTAGGG + Intergenic
1099583014 12:84477232-84477254 AGGGCTAAAAACCTGGTTGACGG + Intergenic
1101062285 12:100984650-100984672 AAGGGTAAATAACTTGTGGAAGG + Intronic
1101391783 12:104307665-104307687 AAGGATAGAAACTATGTTTAGGG + Intronic
1105592695 13:21809496-21809518 AAAGGAAAAAACTTTTTTAAGGG - Intergenic
1105977920 13:25489617-25489639 AAGTGGAAAACCTTTGCTGAAGG + Intronic
1106415280 13:29541113-29541135 AAGGGCAAAACCTGTGTGGAAGG + Intronic
1107708111 13:43126967-43126989 ATGGGTAATAACAATGTTGAAGG - Intergenic
1109129712 13:58567662-58567684 AAAGGTGAAAACATTTTTGATGG - Intergenic
1109144309 13:58758525-58758547 AAGGATAAAAATTTTTTTGAAGG + Intergenic
1109265625 13:60196650-60196672 AAAGGTAAAAATTTTTTAGAAGG + Intergenic
1109379513 13:61541363-61541385 AAGGGTCAGCAATTTGTTGAAGG + Intergenic
1111009402 13:82292392-82292414 TTGGGTAAAAACTTTGCTGCAGG - Intergenic
1111022020 13:82462784-82462806 AGGGGTAAAAAGTTATTTGAGGG - Intergenic
1111528857 13:89510393-89510415 AAAGGTAAACACTCTGTTTATGG + Intergenic
1111752832 13:92356561-92356583 AAGGTAAAAAGATTTGTTGATGG + Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113101960 13:106730633-106730655 AAAAGTAAAAACATTGTAGATGG - Intergenic
1114874901 14:26704043-26704065 AAGGATAGAAACTTTGGTAAAGG - Intergenic
1116772362 14:49142313-49142335 AAGGGTAGAAACTTTCTCAAAGG - Intergenic
1116882860 14:50189171-50189193 AAAGGAAAAAAAGTTGTTGAAGG + Intronic
1117102871 14:52368443-52368465 AAGGGTAAAAATATTGCAGAGGG + Intergenic
1118081664 14:62368339-62368361 AGGGATAATAAGTTTGTTGATGG + Intergenic
1119132631 14:72188732-72188754 AGCGGTAAAAACTTTGTTCCTGG + Intronic
1120463942 14:84831923-84831945 AAGAATAAAAGGTTTGTTGAGGG + Intergenic
1120607634 14:86598897-86598919 AAGTGTAGAAACCTTGTAGAAGG - Intergenic
1122396779 14:101439048-101439070 AAGAGTGAAACCTTTGTTGGTGG - Intergenic
1123850301 15:24349054-24349076 AAGCGTTAAAACACTGTTGACGG + Intergenic
1123855242 15:24403614-24403636 AAGCGTTAAAACACTGTTGACGG + Intergenic
1125179803 15:36869810-36869832 AAGCTTAAAATCATTGTTGAGGG - Intergenic
1126790380 15:52216106-52216128 ATTGGTATAAACTTTCTTGAGGG - Intronic
1128923819 15:71636088-71636110 GAAGGTAAACAATTTGTTGAAGG - Intronic
1129075262 15:72989556-72989578 AATGTTAAAAACTCTGTTGCTGG - Intergenic
1130107346 15:80938873-80938895 AAGGGTAAAAGATCAGTTGATGG + Intronic
1130378394 15:83350844-83350866 AACAGTAACCACTTTGTTGAGGG + Intergenic
1130874962 15:88005802-88005824 AAGGGTAAAAACTTTGTTGAAGG - Intronic
1134484957 16:14650457-14650479 AAGGGTAAAAGCTTTCTTTTAGG - Intronic
1134542562 16:15079306-15079328 AACAGTTAAAACTTTGTTTAAGG - Intronic
1135360142 16:21805385-21805407 AACAGTTAAAACTTTGTTTAAGG - Intergenic
1135427727 16:22353682-22353704 AAGGGGAAGAACTTTGTCTAGGG - Intronic
1135530970 16:23254344-23254366 ATGGATAAAACCTTTGTGGAGGG + Intergenic
1136262666 16:29091555-29091577 AACAGTTAAAACTTTGTTTAAGG + Intergenic
1139249070 16:65477385-65477407 AAGGCTTAAAACCTTGATGATGG + Intergenic
1143567004 17:7728594-7728616 AAGGAAAACAACTTTGTTGCAGG + Intronic
1144234955 17:13251299-13251321 AAGAGTAAAAATTATGTTGGAGG - Intergenic
1144352723 17:14413804-14413826 AAGGGTAAGAAAATTGTAGAAGG - Intergenic
1147238376 17:39074339-39074361 AAGAGAAAAAACTTTTTGGAGGG - Intronic
1154257290 18:12794573-12794595 TAGGGTGAAAACTATGTGGATGG - Intronic
1155422434 18:25669564-25669586 ATGGGTAGAAACTTTCCTGAGGG - Intergenic
1155684617 18:28533282-28533304 TAGAGTGAAAACTTTGTTGCAGG + Intergenic
1156009808 18:32483704-32483726 AAGGGGAAGAACTGTGTTGCTGG + Intergenic
1159061447 18:63518831-63518853 AAGCTTAAAAAATTTGTTTATGG + Intergenic
1159407018 18:68017187-68017209 AATAGAAAAAACTTTTTTGATGG - Intergenic
1164706544 19:30324275-30324297 AAGGATAAAAAAATTGATGATGG - Intronic
1165302207 19:34977291-34977313 AAGGGAAGAAACTTTCATGATGG + Intergenic
1167122399 19:47525956-47525978 AAGGGGAAAATCTTTGTGGTTGG + Intronic
925599115 2:5589947-5589969 AAGGGTACAAACTCTGTTCATGG + Intergenic
926813857 2:16781035-16781057 AAGGGTTAAAATTTTGTCCATGG - Intergenic
929194493 2:39171371-39171393 AAGGGTAAAAACTAAGTTCTTGG - Intergenic
929744886 2:44646642-44646664 AAGGGTAGAAAGTTTCTTGTGGG - Intronic
930292429 2:49511724-49511746 AAGGGCAAAAAATTGGTTAAGGG - Intergenic
930299569 2:49597799-49597821 AAGTTTAAAAAGTTTTTTGAGGG - Intergenic
930856807 2:56027736-56027758 AAGGGTAGATAGTTTATTGAAGG - Intergenic
932626916 2:73304282-73304304 AATGGCAAATCCTTTGTTGAAGG + Intergenic
932970958 2:76541209-76541231 AAGGGCAAACTCTTTGTTTATGG - Intergenic
933330807 2:80890804-80890826 AAGGGTAAAACCATTGTGAAGGG + Intergenic
934925692 2:98380479-98380501 AAGGGCAAACACTTTCTTCAAGG - Intronic
936378329 2:111961940-111961962 AAGGGAAAAAAACTTGCTGAGGG - Intronic
938787442 2:134645252-134645274 AAGGGTAAATACTTAGGTGTAGG - Intronic
939849208 2:147283748-147283770 AGGGCTTAAAACTTTGATGATGG + Intergenic
939957740 2:148540721-148540743 AAGGGTAGAGATTTTGTTCACGG - Intergenic
941718438 2:168787877-168787899 GAGGGTAAAAACTTTGTCCTTGG + Intronic
942343359 2:174973834-174973856 AAAGGTAAAAGGTTTTTTGATGG - Intronic
942518872 2:176782150-176782172 AATGTTAAAATCTTTGTAGAAGG - Intergenic
943252934 2:185552787-185552809 TAGTGTAAAACTTTTGTTGAGGG + Intergenic
943337248 2:186631574-186631596 AAGTCTAAAAACTATGTTGATGG + Intronic
944227387 2:197361451-197361473 ATTGGTAAAAACTTTCTGGAGGG - Intergenic
945928298 2:215828813-215828835 AAGAGGAAAAACTGTGTTTATGG - Intergenic
1169035227 20:2445311-2445333 AATGGTAAGAACTTTGTAGTGGG + Intergenic
1169833938 20:9856520-9856542 AAGGTTAAAAAACTTGTTTAAGG + Intergenic
1170863535 20:20131114-20131136 AAGTGTAAAAACTGAGTAGATGG - Intronic
1172384843 20:34526715-34526737 AAGGGTAACAACTATGATTATGG - Intronic
1173385502 20:42583559-42583581 AAGAGTAAAAACTATGTTCATGG + Intronic
1173751940 20:45483554-45483576 AAGGCAAAAAACTTTATTCATGG + Intergenic
1173851248 20:46219830-46219852 AAGGCTAAGTACCTTGTTGAAGG + Intronic
1177395402 21:20529103-20529125 TAGTGTAAAAACAATGTTGATGG + Intergenic
1178434422 21:32545419-32545441 AAGGGTAAGATCTTTGGAGATGG - Intergenic
1178480733 21:32977543-32977565 AAGGGAATAAACCTTGGTGAGGG - Intergenic
1179237553 21:39560916-39560938 AAGGTTAGGAGCTTTGTTGAAGG + Intronic
1179573104 21:42289700-42289722 AAAGGTAAAAACAATGGTGAGGG - Intronic
1181905477 22:26191775-26191797 AAGGGAAAGGACTTAGTTGATGG - Intronic
1182478433 22:30589975-30589997 AAGGGAACAAAATTGGTTGAGGG - Intronic
1183274493 22:36884706-36884728 AAGGGTAAACACTTTTTTTCAGG + Intergenic
949488311 3:4563096-4563118 AAGGGTAAAAGCTATGATGTAGG + Intronic
953588036 3:44222831-44222853 AATGGTAAAAATTTGGTGGAGGG - Intergenic
955784753 3:62525609-62525631 AAGGGCAAAAACTGTGTAGTGGG - Intronic
960255091 3:115503277-115503299 TAGGGTAAAACCATTGTTTAGGG - Intergenic
960264449 3:115604435-115604457 AAAGGTAACAAATTTGTTAAAGG - Intergenic
961235439 3:125362522-125362544 AAGGGTAAGGACTTTGGTGGGGG - Intronic
963528546 3:146445719-146445741 AAGGGTAGAAAGTTTATTCAAGG - Intronic
964567057 3:158068277-158068299 AAGGGTGTAAATTTTATTGAAGG - Intergenic
964722694 3:159783051-159783073 ATGGGTAAAAACATTGCAGAAGG - Intronic
966377059 3:179307119-179307141 AAGGGAAAAAACTTTAGTTATGG - Intergenic
967173268 3:186840663-186840685 GAGGGTAAATAATTTGTTCAAGG - Intergenic
970133528 4:12896835-12896857 AAGAGTGAAAACATTGTTGCAGG + Intergenic
975160960 4:71122890-71122912 AAGGGTAGAAAATTTGCTTAAGG + Intergenic
975373734 4:73618464-73618486 AAGGCAAATAACTTTGTTTAAGG + Intronic
979420278 4:120496103-120496125 AAGTTTATAAAATTTGTTGAGGG + Intergenic
979840458 4:125433283-125433305 AAGGGAAATAACTTTATTGAAGG + Intronic
979952334 4:126908451-126908473 AAGGGTGAAATGTTTGCTGATGG - Intergenic
980492506 4:133546772-133546794 AAGTGTAAATATTTTATTGAAGG - Intergenic
980857651 4:138459154-138459176 AAGGATAAAAACCTTCTGGAAGG - Intergenic
981576151 4:146207937-146207959 AAAGTTAAAAAATTTGATGAAGG + Intergenic
981736404 4:147956980-147957002 AAGTTTAAAGAGTTTGTTGAAGG + Intronic
982259896 4:153485923-153485945 AAGGTAAAACAATTTGTTGAAGG + Intronic
983199419 4:164844813-164844835 AAAGGTAAACGATTTGTTGAAGG + Intergenic
983616282 4:169709202-169709224 AATGATAAATACTTTATTGAAGG + Intronic
985851688 5:2393133-2393155 ATGGGTCAACACTTCGTTGAGGG - Intergenic
986600369 5:9467034-9467056 AAGGGCCAAAACTTTGTTTCTGG - Intronic
989669567 5:43899682-43899704 AAGGGTAAGAAAGTTGTTGGTGG - Intergenic
991582404 5:68170021-68170043 AAGGGTAAAAAATAAGTTAAGGG - Intergenic
992905943 5:81345733-81345755 AAGGGTTAAAAATATGTTCATGG + Intronic
993417266 5:87650515-87650537 AAGGGTAAAGAATTTGATGGTGG - Intergenic
993814186 5:92520617-92520639 AAGGGTACAAAGTTTGTTAGAGG - Intergenic
993825976 5:92687167-92687189 ATGAAGAAAAACTTTGTTGAGGG + Intergenic
995432928 5:112101969-112101991 AAGGGGAAAAAATTGGTTTACGG + Intergenic
995817557 5:116189024-116189046 AAGAATAAAAAATTTATTGATGG + Intronic
997444098 5:133928781-133928803 AAGGGTAAAAGCTTATTTGCGGG - Intergenic
1003261836 6:4524450-4524472 AAGGATAAAGACTTTTATGATGG + Intergenic
1003536125 6:6977027-6977049 AAGGGTAAAAACTTAGATTAAGG + Intergenic
1003740424 6:8931430-8931452 CAGGATAAAACCTTTGTTGGAGG - Intergenic
1004064734 6:12232949-12232971 AAGGTCAAAAAATTTGGTGAAGG + Intergenic
1006078209 6:31547904-31547926 AAGGGTAAATAATTGGTTTAAGG - Intronic
1009486130 6:64224659-64224681 AAGGGAAAAATCTTTGTTTATGG + Intronic
1009610774 6:65937975-65937997 AAGAGAAAAAACTTTTTTGGGGG - Intergenic
1009883446 6:69597528-69597550 CAGGGTAATTATTTTGTTGAAGG - Intergenic
1012030422 6:94053061-94053083 AAGTTTTAAAACTTTGTCGATGG - Intergenic
1013075899 6:106771477-106771499 AAAGCTGAAAACTTTCTTGAAGG + Intergenic
1013337076 6:109174360-109174382 AAGGGTAGAAACTTTACAGAAGG - Intergenic
1013727672 6:113119735-113119757 AAGGATATAGAGTTTGTTGATGG + Intergenic
1016098634 6:140069474-140069496 ATGGGTAAAAATCTTGCTGATGG - Intergenic
1017521354 6:155206002-155206024 AAGGGCAAAACATTTGTTAAAGG - Intronic
1018726825 6:166619098-166619120 AAGTGAAAAAACTTTGCTGATGG - Intronic
1020980836 7:15066245-15066267 GATGGTAAAAACTTTGTTTTTGG + Intergenic
1021990659 7:26138504-26138526 AAGGGTACAAACGTTGTTATAGG - Intergenic
1022402597 7:30054230-30054252 AGTGGTGAAAACTTTGTTGCCGG - Intronic
1024949422 7:54843754-54843776 AAGGTTAAATAATGTGTTGAAGG + Intergenic
1025845588 7:65193757-65193779 AAAACTAAACACTTTGTTGAGGG - Intergenic
1025895807 7:65699470-65699492 AAAACTAAACACTTTGTTGAGGG - Intergenic
1028236323 7:88366516-88366538 AAGGTTAAAAAATTTGTTCTAGG - Intergenic
1028510461 7:91619941-91619963 AAGGGTAAAAACAGAGTGGATGG - Intergenic
1028754573 7:94420592-94420614 AAGGGTGAAAACGGTGTTGTTGG + Exonic
1031846341 7:126809621-126809643 AAGGATAATAATTTTGTGGATGG - Intronic
1033882155 7:145898608-145898630 TAGGCCAAAAACTCTGTTGAAGG - Intergenic
1037321925 8:17651857-17651879 CAGGGTATAAACTTTATTGATGG - Intronic
1038854429 8:31315648-31315670 AAGGTTAAATGATTTGTTGAAGG - Intergenic
1038884003 8:31642567-31642589 AGGGGAAAAAACTTCATTGAAGG + Intronic
1038958085 8:32488918-32488940 TAGGATAAAAACTTCATTGAGGG + Intronic
1039620111 8:38989251-38989273 AGGGGTAAGAGCTTGGTTGAAGG - Exonic
1039724715 8:40203717-40203739 AAAGATAAAATCTTTGTTTAAGG - Intergenic
1041186886 8:55310312-55310334 AAGGATAAGGACTTTGCTGAAGG - Intronic
1045608922 8:103812112-103812134 AAGTTTTAAAAATTTGTTGATGG - Intronic
1046037416 8:108860939-108860961 AAAAATAAAAACTTTGTTAAAGG + Intergenic
1046199166 8:110899600-110899622 AGGGATAACAAATTTGTTGATGG + Intergenic
1046515854 8:115259620-115259642 AAGGGTAAAAACTAAGTGGATGG - Intergenic
1047268926 8:123336195-123336217 AAGGTTAAAAACATTGCTGAAGG - Intronic
1050342067 9:4650376-4650398 AAGGGTGAAAAGTGTGTGGATGG - Intronic
1050613721 9:7380129-7380151 GAGGGTAAAGAATTTGTTCAGGG + Intergenic
1050751082 9:8938142-8938164 CAGGGTAACCAATTTGTTGATGG + Intronic
1051114997 9:13684567-13684589 AAAGGCAGAAATTTTGTTGATGG - Intergenic
1051591679 9:18782516-18782538 AAGGCTAAAGACTTTCTTTACGG + Intronic
1059168284 9:112099620-112099642 TAGGGAAAAAACTTTCGTGAAGG + Intronic
1060288582 9:122278208-122278230 AAGGTTAAAAAATTAGTTAAGGG - Intronic
1061696634 9:132380731-132380753 AATGGTAAAAATTATATTGAAGG - Intronic
1187681029 X:21768176-21768198 TTGGGTAAAAATCTTGTTGAAGG - Intergenic
1189428384 X:40923842-40923864 AAGTTTGAAAACTTTCTTGATGG + Intergenic
1191112439 X:56815135-56815157 AAGAGTAAATAATTTATTGATGG - Intergenic
1193648714 X:84102698-84102720 AGGAGTACACACTTTGTTGAAGG + Intronic
1194061737 X:89211698-89211720 GAGGCCAAAAACTTTGCTGAAGG - Intergenic
1194383880 X:93229033-93229055 AAGGGAAATTACTTTTTTGAAGG + Intergenic
1194949058 X:100103288-100103310 GAGGTTAAAAAATTTGTTCAAGG - Intergenic
1195860267 X:109375735-109375757 ATGGGTGAAAACCTTGTTGTGGG - Intronic
1197066678 X:122241456-122241478 AAGAGTACAAACTATATTGAGGG - Intergenic
1197809660 X:130429984-130430006 AAAGGTGAAGACTTTGATGAAGG + Intergenic
1200715661 Y:6541002-6541024 GAGGCCAAAAACTTTGCTGAAGG - Intergenic