ID: 1130875312

View in Genome Browser
Species Human (GRCh38)
Location 15:88008680-88008702
Sequence GTTCTGATGAGGAGCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 121}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130875302_1130875312 29 Left 1130875302 15:88008628-88008650 CCCAGTTCTGAGTCCCAGTCTCC 0: 1
1: 1
2: 2
3: 40
4: 294
Right 1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1130875305_1130875312 16 Left 1130875305 15:88008641-88008663 CCCAGTCTCCTGACACTCAAGGC 0: 1
1: 0
2: 0
3: 24
4: 179
Right 1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1130875308_1130875312 8 Left 1130875308 15:88008649-88008671 CCTGACACTCAAGGCTCTTGGTG 0: 1
1: 0
2: 0
3: 11
4: 125
Right 1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1130875306_1130875312 15 Left 1130875306 15:88008642-88008664 CCAGTCTCCTGACACTCAAGGCT 0: 1
1: 0
2: 0
3: 19
4: 237
Right 1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 121
1130875303_1130875312 28 Left 1130875303 15:88008629-88008651 CCAGTTCTGAGTCCCAGTCTCCT 0: 1
1: 0
2: 7
3: 52
4: 432
Right 1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130875312 Original CRISPR GTTCTGATGAGGAGCAACCA GGG Intronic
902197746 1:14810303-14810325 GTTCTGAAGAAAAGCAAGCAAGG - Intronic
904400556 1:30253934-30253956 ATGGTGATGAGGAGCCACCAGGG + Intergenic
907469929 1:54666758-54666780 ATTCTGTTGAGGAGCAATAAGGG + Intronic
912637864 1:111315278-111315300 GTTCTCAGGAGTAGAAACCATGG - Exonic
912656626 1:111491652-111491674 TTTTTGATGAGGAGCAACTGAGG - Intronic
913053321 1:115135614-115135636 CATCTGATGATAAGCAACCATGG + Intergenic
913716425 1:121538783-121538805 GTGCTAAGGAGAAGCAACCAAGG + Intergenic
915333097 1:155125739-155125761 GTTCTGAAAAGGAGCCAGCAGGG - Intergenic
921021996 1:211244375-211244397 GGTCTGAGGAGGAGGAAGCAGGG - Intergenic
921124581 1:212166135-212166157 GTCCTGCTGAGGAGCACCAAAGG - Intergenic
923095843 1:230774498-230774520 GTCATGATGAAGAGCAACAATGG - Intronic
923459311 1:234194885-234194907 GTTATGCTGAGGAGCAATTAGGG + Intronic
1063684547 10:8224399-8224421 GCTGTGATGAGGAAGAACCAAGG + Intergenic
1065363835 10:24915740-24915762 AGTCTGAGGAGGAGCAACCAGGG - Intronic
1067233136 10:44425869-44425891 GTTGTTATGAGGAGCCAACAGGG - Intergenic
1069591257 10:69643692-69643714 GTTCTGCTGAGGATTAAGCAAGG - Intergenic
1072415856 10:95246219-95246241 GTGCTGATGAGGAACTACCAGGG + Intronic
1072637742 10:97188272-97188294 GTTCTGGGGTGGAGGAACCAGGG - Intronic
1073587716 10:104726650-104726672 TTTCTGAGGAGGAGCAACTTTGG - Intronic
1076316271 10:129544182-129544204 GTTTTCATGAGGAGGAAACATGG + Intronic
1076587032 10:131556307-131556329 GTGCTGATGAGGGTCAACCCAGG + Intergenic
1078570575 11:12454114-12454136 GCTCTGCTGAGGAGCCTCCAGGG - Intronic
1078644347 11:13126090-13126112 GTTGTTGTGAGGATCAACCAAGG - Intergenic
1080022744 11:27580599-27580621 ATTCTGATGAGGAACAATAAGGG - Intergenic
1083882892 11:65557317-65557339 GTTCTGAGCAGGAGCACACAGGG - Intronic
1084054971 11:66626136-66626158 GTTCTGTTGATAAACAACCAAGG + Intronic
1084372132 11:68751228-68751250 GGTCAGGTGAGGAGCAGCCAGGG + Intronic
1084514663 11:69630108-69630130 TTCCTGATGAGGCGCAAACATGG - Intergenic
1085029751 11:73263901-73263923 GTTATGAAGAGGAGGAAGCAGGG + Intergenic
1085845581 11:80060794-80060816 TTTGTGAAGAGGAGCCACCAAGG + Intergenic
1086007848 11:82061236-82061258 GGTCTGGTGAGCAGCAATCATGG - Intergenic
1090189118 11:124756916-124756938 GTTCTGGTGAAGAGGACCCAGGG - Intronic
1091765297 12:3116412-3116434 GTTCTGATGAAGATGAAACACGG + Intronic
1095928521 12:47603490-47603512 GGTCTGATCAGGAACAACCCTGG + Intergenic
1101066432 12:101027029-101027051 GTTCTGATGAGAAGATACCTTGG - Intronic
1102092729 12:110206385-110206407 ATTGTGATGAGGAGCAAAGAAGG - Intronic
1103500555 12:121398628-121398650 TTTCTAATGAGGGACAACCATGG + Intronic
1106559274 13:30834421-30834443 GTTATGCTAAGGGGCAACCACGG - Intergenic
1107061089 13:36160545-36160567 CTTCTGATGACGAGCGACCTAGG + Intergenic
1107821932 13:44293757-44293779 GTTCCAATGAGGACCAACCTGGG - Intergenic
1112124917 13:96454271-96454293 GTGCTGATGCGGACCAGCCATGG + Intronic
1112730069 13:102350982-102351004 GGTCTGAGGAGGAGCAACGTGGG - Intronic
1113392242 13:109908848-109908870 GATCTGAGGAGGAGCAGTCAAGG - Intergenic
1114488684 14:23081781-23081803 ACTCTGATGATGAGAAACCAAGG - Exonic
1120802265 14:88704005-88704027 GTTCTGATGAGGAGTGAATAAGG - Intronic
1121680284 14:95787903-95787925 GCTCTGATGGGGATGAACCAGGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123888229 15:24748878-24748900 GCTCTGAGGAGGCGCAGCCAGGG + Intergenic
1125343451 15:38696600-38696622 GTTCTGATATGGAGCTACAAGGG + Exonic
1126955186 15:53925945-53925967 GTTCCCTTGAAGAGCAACCACGG + Intergenic
1130875312 15:88008680-88008702 GTTCTGATGAGGAGCAACCAGGG + Intronic
1133306603 16:4813478-4813500 CTTATGATGAGAAGCAACCCAGG - Intronic
1134171586 16:11973873-11973895 ATTCTGTTGAGGAGCAATAAAGG + Intronic
1138121789 16:54406025-54406047 GAGGTGGTGAGGAGCAACCAGGG + Intergenic
1140625317 16:76787273-76787295 GTTCTGACTAGTAGCAGCCAGGG + Intergenic
1140698331 16:77557559-77557581 CTTCTGATGAGCAAGAACCATGG + Intergenic
1141771145 16:86090290-86090312 GCCCTGAGGAGGAACAACCAGGG - Intergenic
1143494216 17:7302260-7302282 GTTCCACTGAGGAGCACCCATGG + Intergenic
1147970454 17:44216808-44216830 CTTCAGATGGGAAGCAACCAGGG - Intronic
1148242703 17:46010887-46010909 GTTCTGATGAGCGGACACCAAGG + Intronic
1149231923 17:54544671-54544693 GTCCGGATGAGGGGCAAGCACGG + Intergenic
1152660694 17:81540616-81540638 ATTCTGATTGGGAGCAACCGAGG - Exonic
1155157076 18:23166872-23166894 CTTCTGATGAGGAGCCACCCTGG - Intronic
1159332044 18:67008375-67008397 GTTCTGATGAGGATGTACAAGGG - Intergenic
927178282 2:20425417-20425439 GATCTGATGATGAGCAACACAGG + Intergenic
939648598 2:144733916-144733938 TTACTGATTATGAGCAACCATGG + Intergenic
941084438 2:161100379-161100401 TTTCTGTTGATGAGCATCCAAGG - Intergenic
946292426 2:218755255-218755277 GTTCTGCTGTGCAGCAAGCAGGG + Exonic
1169858906 20:10131832-10131854 GTTGGCATGAGGAGCCACCAAGG + Intergenic
1170680534 20:18521678-18521700 GGCCTGGTGAGGAGCAACCTGGG + Intronic
1172065989 20:32220903-32220925 GTTCTGAGAGGGAGCATCCAGGG + Intronic
1172339095 20:34142310-34142332 CTTCAGATGAGAAGGAACCAGGG - Intergenic
1173414956 20:42847107-42847129 GTTCGAATGAGGAGAATCCAAGG + Intronic
1174067628 20:47877078-47877100 GTTTGAATGAGGAGGAACCAGGG - Intergenic
1175492869 20:59390683-59390705 GTCCTGGTGAGGAGCAGGCAAGG + Intergenic
1182030542 22:27155994-27156016 GTTCAGATGAGAAGGAGCCATGG - Intergenic
1183351913 22:37339217-37339239 GGTTTAATGGGGAGCAACCAGGG - Intergenic
1185054193 22:48569543-48569565 GCTCTGGTGAGGAGGGACCATGG - Intronic
950143098 3:10628646-10628668 GTTGCTATGAGGAGCAACTATGG - Intronic
950607631 3:14096818-14096840 TTTCTGATGAGGGGCAGCAAGGG - Intergenic
959531770 3:107441418-107441440 GTTCTGTGGATGAGCAACCAGGG - Intergenic
959535173 3:107476604-107476626 GCTTAGATGAGGAGCAACAATGG + Intergenic
959979197 3:112496133-112496155 GTTCAGTTGAGGATCAACCAAGG - Intronic
960127891 3:114020410-114020432 TTTCTCATTAGGAGAAACCATGG + Intronic
960943654 3:122951754-122951776 ATTCTGATGAGCAGCTCCCAGGG + Intronic
966329269 3:178793057-178793079 GTTCTGCTGCTGAGCCACCATGG + Intronic
966568749 3:181415358-181415380 TTTCTTATGAGTAGCAAACATGG - Intergenic
967690375 3:192466828-192466850 GTTATAATGAGGAGAAGCCAGGG - Intronic
971049741 4:22848047-22848069 CTTCTGAACAGGAGCATCCAAGG - Intergenic
974057809 4:57001800-57001822 GTTCAGATAAGGAGCATCAATGG - Intronic
974667134 4:64977673-64977695 GCTCTGCTGAGGAGAAAGCATGG + Intergenic
983814565 4:172107459-172107481 GTTCTAATAAGGAGTCACCATGG + Intronic
989565588 5:42898216-42898238 ATTCTTATGAGGAGCATGCAAGG - Intergenic
990610520 5:57452336-57452358 GTTCTGGTTAGGGGCTACCAAGG + Intergenic
991987320 5:72302426-72302448 GTTATGTTTGGGAGCAACCATGG + Intronic
992610475 5:78504264-78504286 GTTCTGAAGGTGGGCAACCAAGG + Intronic
995238481 5:109858158-109858180 GTTCTGATTATGAGCCAGCATGG - Intronic
998329631 5:141313065-141313087 TTTCTCATGAGTAACAACCAAGG + Intergenic
1001922461 5:175611270-175611292 GGTCTGAGGAGGAGGGACCAGGG - Intergenic
1003119021 6:3304938-3304960 GCTCTGATGAGCAGCAGCCACGG + Intronic
1004028816 6:11846133-11846155 GTTCTGTTGAGAAAGAACCAAGG + Intergenic
1007393617 6:41564698-41564720 GTTCTCATGAGGAGAAATCATGG + Intronic
1014465586 6:121752582-121752604 GTTCTGTTTTGGAGCATCCAAGG + Intergenic
1014570771 6:123004989-123005011 GTTCTGAGTAGGAGGCACCATGG + Intronic
1015881463 6:137874402-137874424 GTTCTAAGGAGGAGCACACAGGG - Intronic
1018247919 6:161840075-161840097 CTTCTGCTGAGGAACAAACAAGG + Intronic
1028682966 7:93559343-93559365 GTTCTGCTGAACAGCAATCATGG - Intronic
1029210667 7:98905651-98905673 ATTCTGATGAGCATCATCCAGGG + Intronic
1029284692 7:99457619-99457641 GCTCTGATGAAGAGGAAGCAGGG + Intronic
1033211428 7:139462918-139462940 GGCCTGGTGAGGAGCAACCTGGG - Intronic
1033846994 7:145445403-145445425 GTCCTGAGGAGGAGCATCAAGGG - Intergenic
1034913880 7:155021093-155021115 GGTTTGATGAAGAGCAACAAAGG + Intergenic
1038643053 8:29342622-29342644 GTTCTGCTGAGTGGCAGCCATGG - Intronic
1040583077 8:48713340-48713362 GTTCTCATCAAGTGCAACCAAGG - Intronic
1043485802 8:80698273-80698295 GATTTGATGAGGACCAACCTAGG + Intronic
1043597547 8:81902582-81902604 GACCTGATGAGGAGCAGCCTGGG + Intergenic
1044533503 8:93334429-93334451 GTGCAGATGGGGAGCAACAATGG + Intergenic
1048370283 8:133771171-133771193 GTTCTCATTATGTGCAACCAAGG + Intergenic
1048592808 8:135837184-135837206 GCCCTGATTAGGAGCAATCAAGG + Intergenic
1053749192 9:41235742-41235764 GTTCTGACGAGGACCCGCCATGG + Intergenic
1054254629 9:62800595-62800617 GTTCTGAGGAGGACCCGCCATGG + Intergenic
1057821453 9:98334410-98334432 GTTCTCATGCGTAGCAAGCAAGG + Intronic
1060981468 9:127794743-127794765 GTTCTGGTGGGAAGGAACCATGG + Intronic
1061636631 9:131914689-131914711 GTTCTGCTCAGGAGAATCCACGG - Intronic
1186286477 X:8049216-8049238 GGTTTTATGAGCAGCAACCAGGG + Intergenic
1187702257 X:21973996-21974018 GGCCTGATGAGGATCCACCAAGG - Intronic
1191666889 X:63712776-63712798 GTTAGGATGAGGAACAATCAGGG - Intronic
1194034060 X:88848983-88849005 GTTTGAATGAGGAGCAAACAAGG - Intergenic
1202061966 Y:20897874-20897896 GGTCTGGTGAGGAGCAGCCTGGG - Intergenic