ID: 1130878200

View in Genome Browser
Species Human (GRCh38)
Location 15:88032377-88032399
Sequence TGCACACTTCGGGGCACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130878195_1130878200 12 Left 1130878195 15:88032342-88032364 CCTAGCGCTGGGGCTGTGATCTG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1130878200 15:88032377-88032399 TGCACACTTCGGGGCACTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130878200 Original CRISPR TGCACACTTCGGGGCACTGG AGG Intronic
900574186 1:3374902-3374924 CGGCCACTTCGGGCCACTGGTGG - Intronic
903277547 1:22231545-22231567 GGCACAGTTCGAGGCCCTGGAGG + Intergenic
903747218 1:25595745-25595767 TACATACTTCCGGGAACTGGAGG - Intergenic
905628103 1:39501867-39501889 TGAACACTTCTGGGCATTGCTGG - Intronic
907274217 1:53308206-53308228 GGCACACTTCAAGGCACTGTGGG + Intronic
907982214 1:59494772-59494794 TGTACACTTTGGGGTACTAGAGG + Intronic
911153477 1:94617769-94617791 TGTAAACTTCATGGCACTGGTGG - Intergenic
914984083 1:152441617-152441639 TGCACACATCTGGGCAGTGGTGG - Intergenic
920539089 1:206763966-206763988 AGCACACTTGGGGGTAGTGGGGG + Intergenic
921314535 1:213877788-213877810 TGCACATGTAGGGGCACTGGAGG + Intergenic
1062974244 10:1671980-1672002 TGCACACTTCGGGGGGCGGAGGG + Intronic
1067683701 10:48455236-48455258 TGCATTCTTGGGCGCACTGGGGG + Intronic
1067685130 10:48462234-48462256 TGCACACTTCGGGGTGGGGGGGG + Intronic
1071497022 10:86175627-86175649 GGCACAGCTCTGGGCACTGGAGG - Intronic
1075701575 10:124473215-124473237 TGCACGTTGTGGGGCACTGGGGG - Intronic
1083728101 11:64638713-64638735 TGCACAATTCAGCTCACTGGTGG - Intronic
1084351945 11:68608426-68608448 TGCAGCCTGCGGGGCCCTGGTGG + Intronic
1084520683 11:69660885-69660907 GGCATACTTCTGGGCACTGGTGG - Intronic
1084769920 11:71335866-71335888 TGGAAACTTCTGGGCTCTGGAGG + Intergenic
1086892259 11:92271600-92271622 AGCACTGTTCTGGGCACTGGAGG - Intergenic
1089771233 11:120804736-120804758 TGCACATTAAGAGGCACTGGGGG - Intronic
1091192144 11:133704985-133705007 TGCACACATAGGGGCCCAGGCGG + Intergenic
1096584868 12:52613557-52613579 AGCACTCTCCTGGGCACTGGGGG - Intronic
1097925543 12:65122144-65122166 GGCACTCTTCCGGGCACTGCCGG - Intergenic
1102679487 12:114681702-114681724 TGCAGACTTCGGTGCACTCCTGG + Intronic
1103884838 12:124192567-124192589 TGCACACCTCGTGCCACTCGGGG + Intronic
1107409317 13:40143766-40143788 TGCACACATCAGGGAAGTGGTGG - Intergenic
1113231481 13:108217813-108217835 TGTACACTTCAGTGCACAGGGGG + Intronic
1122198365 14:100106933-100106955 ACCACACTTCCAGGCACTGGAGG - Intronic
1122785915 14:104163188-104163210 TGCCCATTTGGGGGCACAGGTGG - Intronic
1123881217 15:24678562-24678584 TCCACACTTGGGGCCACTGATGG + Exonic
1126176563 15:45741415-45741437 GTCACACTTTGAGGCACTGGGGG - Intergenic
1128153320 15:65377010-65377032 TGCACACTTCGGGGAAGGGCAGG + Intronic
1128944939 15:71813701-71813723 TGCACACATGGGGGTAGTGGAGG - Intronic
1129796629 15:78382349-78382371 TGCACACTCCGTGGAGCTGGTGG + Intergenic
1130878200 15:88032377-88032399 TGCACACTTCGGGGCACTGGAGG + Intronic
1132575110 16:660547-660569 TGCAGGCTTTGGGGCACAGGTGG + Intronic
1132659817 16:1056278-1056300 TGAACACTTCTGGGCACAGCAGG + Intergenic
1133337398 16:5015002-5015024 TGGACATTTCTGGACACTGGAGG - Exonic
1140935904 16:79670014-79670036 GGCACACTTCGTGTCACTAGAGG + Intergenic
1141664708 16:85460030-85460052 TGTGCACTGCGGGGCCCTGGGGG - Intergenic
1141689029 16:85586251-85586273 GGCACATTTTGTGGCACTGGGGG + Intergenic
1141853721 16:86666513-86666535 TGAACACTTCTTGGCAATGGTGG + Intergenic
1143524134 17:7462659-7462681 TGCACACCTTGGCGCAGTGGGGG + Exonic
1146213212 17:30957952-30957974 TGCTGACTGCGGGGCACTGATGG - Exonic
1146885187 17:36465545-36465567 TGCACACAACTGTGCACTGGGGG + Intergenic
1149635200 17:58161505-58161527 TGAACACTAAGGGGAACTGGAGG + Intergenic
1151802700 17:76387136-76387158 TGCACACCTTGTGCCACTGGAGG + Exonic
1156135428 18:34032004-34032026 TGCACTCTTCCGGGGACTAGTGG + Intronic
1157596751 18:48868873-48868895 TGCACATTTCTGGGAACTGGAGG - Intergenic
1159994545 18:74951145-74951167 TGAACATTTGGAGGCACTGGGGG - Intronic
1162833716 19:13302881-13302903 TGAATACCTCGAGGCACTGGAGG + Intronic
1163045630 19:14639661-14639683 TGCACACTGGGAGGCAATGGTGG - Intronic
1167791748 19:51687888-51687910 TGGAGACTGCTGGGCACTGGGGG - Intergenic
925305792 2:2847239-2847261 TGCGCACTGAGGGCCACTGGGGG - Intergenic
929578712 2:43068511-43068533 TGCAGACTTAGGGCCTCTGGCGG + Intergenic
931501594 2:62874990-62875012 TGCACACATGTGTGCACTGGAGG - Intronic
932008644 2:67953513-67953535 AGCACACTGAGGTGCACTGGGGG + Intergenic
936251735 2:110873170-110873192 TGCACACCATGGGTCACTGGTGG + Intronic
936827983 2:116604648-116604670 TGAAGACTTCGGGGGACTGTTGG + Intergenic
940423907 2:153509343-153509365 TGCGCACTCCGTGGAACTGGTGG - Intergenic
941616843 2:167730005-167730027 TGCACCCTTCTGGGCACTGCAGG - Intergenic
948530071 2:238598599-238598621 TGGACACAGCGGGGCACAGGAGG - Intergenic
948877856 2:240839737-240839759 CTCACAGTGCGGGGCACTGGAGG - Intergenic
1169388063 20:5167932-5167954 GGCAGACTTCAAGGCACTGGTGG - Intronic
1170653899 20:18268211-18268233 TGAACACTTGGGGGTTCTGGAGG + Intergenic
1170989959 20:21292256-21292278 AGCACACGGCGGGGGACTGGGGG + Intergenic
1174189192 20:48728181-48728203 TGCACAGTTCCAAGCACTGGGGG + Intronic
1174297934 20:49562173-49562195 TGCCCACTTAGGGTGACTGGGGG - Intronic
1176229152 20:64022764-64022786 TGCACACTCCAGGGCATTGTGGG - Exonic
1177464571 21:21458455-21458477 AGCACACTTAGGGGCAGTGTGGG + Intronic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1179611266 21:42552828-42552850 TGCTCACTGCGGGGGACGGGGGG + Intronic
1182128219 22:27831736-27831758 TGCACACCTCCGGGCATGGGAGG + Intergenic
1183710916 22:39502637-39502659 GGCCTGCTTCGGGGCACTGGAGG - Intronic
950027125 3:9827725-9827747 TGCACTGTTCTGGGCACTTGGGG + Intronic
950967225 3:17154760-17154782 AGCACACTGTGGGGGACTGGGGG + Intergenic
951633831 3:24751322-24751344 TGCACTCTGCTAGGCACTGGGGG + Intergenic
954085505 3:48241086-48241108 TGCGCACCGCGGGCCACTGGCGG - Exonic
954215172 3:49120631-49120653 GGCACGCTGCGGGGCACTAGGGG + Intronic
956079637 3:65544359-65544381 TGCACACTGTGGGGAACTGGGGG + Intronic
960376164 3:116904367-116904389 TGCATACTTGGGTGCACTGGGGG - Intronic
964182261 3:153902994-153903016 TGCACACTTTGGGGGGCTGTAGG + Intergenic
965386604 3:168053962-168053984 TCCCTACTTCTGGGCACTGGAGG - Intronic
968706418 4:2080436-2080458 GGCACACTGCCTGGCACTGGTGG + Intronic
968706435 4:2080496-2080518 GGCACACTGCCTGGCACTGGTGG + Intronic
973764229 4:54149285-54149307 GGCACATGGCGGGGCACTGGTGG - Intronic
975034964 4:69668792-69668814 AGAGCACTTCTGGGCACTGGAGG + Intergenic
975656467 4:76645974-76645996 TGCCCACTTTGGGGGACTGTTGG - Intronic
976760619 4:88545076-88545098 TTCACACTCTGAGGCACTGGGGG + Intronic
979150726 4:117310991-117311013 GGCACACCTCTGGGCACTCGGGG - Intergenic
982924754 4:161321383-161321405 TGCTCACTGCTGGACACTGGTGG + Intergenic
988854789 5:35217358-35217380 TGCACACATCTGGGTATTGGTGG - Intronic
992249635 5:74865044-74865066 TGCACACATTTGGGCCCTGGAGG - Intronic
994219253 5:97175972-97175994 TGCATATTTTGTGGCACTGGCGG - Intronic
998142902 5:139709887-139709909 TGCACTCGACGGGGCGCTGGGGG + Intergenic
998152341 5:139764609-139764631 TGCCCACTGCGGGGCGCCGGGGG - Intergenic
999119416 5:149197826-149197848 TGCACACTAAGAAGCACTGGTGG - Intronic
1001707705 5:173753714-173753736 TGGTCATTTGGGGGCACTGGAGG + Intergenic
1008574671 6:52848790-52848812 TGGAGACTTTGGGGCACTGAAGG + Intronic
1014402856 6:121012671-121012693 GGCACTCTTCTGGGCACTGGGGG - Intergenic
1018793226 6:167165882-167165904 TGCACAGTGCTAGGCACTGGAGG + Intronic
1018823498 6:167392529-167392551 TGCACAATGCTAGGCACTGGAGG - Intergenic
1019198637 6:170296605-170296627 CGCACACCTCGGAGCCCTGGGGG + Intronic
1019289290 7:242500-242522 AGCACTGTTCGGTGCACTGGGGG + Intronic
1022080094 7:27011971-27011993 AGAGCACTTCTGGGCACTGGGGG + Intergenic
1022087401 7:27081744-27081766 TGCACATTTTGGGGCAAGGGAGG - Intergenic
1026775074 7:73226235-73226257 TTCACACCTCAGGGCACTGGGGG + Intergenic
1027015930 7:74779606-74779628 TTCACACCTCAGGGCACTGGGGG + Intronic
1027072099 7:75166331-75166353 TTCACACCTCAGGGCACTGGGGG - Intergenic
1029746237 7:102517213-102517235 TGCACACTCCGGGGCATTAAGGG + Intronic
1029764175 7:102616192-102616214 TGCACACTCCGGGGCATTAAGGG + Intronic
1030078989 7:105761267-105761289 TCCACACTTCAGGGCTCTGCTGG + Intronic
1032443495 7:131960441-131960463 TGCACACTGTGGGCCCCTGGGGG + Intergenic
1032695016 7:134328078-134328100 AGGACACTAGGGGGCACTGGAGG - Intergenic
1032709097 7:134447081-134447103 TGCACAGCACGGGGCCCTGGAGG + Intronic
1032796533 7:135281687-135281709 TGGACACTTGGGGGCAGTGTGGG + Intergenic
1035763201 8:2085186-2085208 AGCCCACCTCGGGGCACTGGAGG - Intronic
1036627131 8:10481522-10481544 TGCAAACTTTTGGGCACTGGAGG + Intergenic
1037907855 8:22725901-22725923 TGTGCACTTCCGGCCACTGGTGG + Intronic
1038461197 8:27718494-27718516 TTCACACTTCTGGGCACTGGGGG - Intergenic
1045833877 8:106496996-106497018 TGCACCATTCTGGGCACGGGAGG + Intronic
1047190322 8:122673631-122673653 TGCCCTCTTCTGGGCACTGGTGG - Intergenic
1050130361 9:2406340-2406362 TGCACACTCCGTGGAGCTGGTGG + Intergenic
1050307173 9:4316579-4316601 TGCACACTTTGGGGTATGGGTGG - Intronic
1055386086 9:75763486-75763508 TTCACACTTAGAGGTACTGGAGG - Intergenic
1057217813 9:93239113-93239135 TGACCACTTCGGGGCTCTGCAGG - Intronic
1060751032 9:126169710-126169732 TGTACCCTCAGGGGCACTGGAGG - Intergenic
1062567487 9:137169802-137169824 TGCACACCTCGGGGCAGTCCGGG + Exonic
1186197801 X:7127155-7127177 TCCACACATGGGGGCACTGAAGG + Intronic
1186911812 X:14175035-14175057 TGCACACTGCTGGGGAATGGGGG + Intergenic
1189083454 X:37997221-37997243 TGCACACTTTGTGGAGCTGGTGG + Intronic
1189711163 X:43813760-43813782 GGCACTGTTCTGGGCACTGGAGG + Intronic
1194391476 X:93322613-93322635 AGCATATTTCTGGGCACTGGGGG - Intergenic
1195900547 X:109793032-109793054 CGCACACTTTGGGGCATAGGTGG - Intergenic
1196188072 X:112765531-112765553 GGCACTCTTCTGGGCTCTGGAGG + Intergenic
1196539054 X:116883407-116883429 AGAGCACTTCTGGGCACTGGGGG - Intergenic
1197127744 X:122967765-122967787 AGCACCCTTCAAGGCACTGGGGG + Intergenic
1201642880 Y:16198271-16198293 TCCACACTCCAGGACACTGGAGG + Intergenic
1201659935 Y:16387050-16387072 TCCACACTCCAGGACACTGGAGG - Intergenic