ID: 1130879775

View in Genome Browser
Species Human (GRCh38)
Location 15:88045029-88045051
Sequence GATGGGCAGGTGCCAACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130879775_1130879780 -2 Left 1130879775 15:88045029-88045051 CCAGGTGTTGGCACCTGCCCATC 0: 1
1: 0
2: 1
3: 13
4: 195
Right 1130879780 15:88045050-88045072 TCTTAGGTAGCACATCTCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130879775 Original CRISPR GATGGGCAGGTGCCAACACC TGG (reversed) Intronic
900658428 1:3771628-3771650 GGTGGGACAGTGCCAACACCGGG - Exonic
900763132 1:4486368-4486390 GATGGCCAAGTGCCTACATCTGG + Intergenic
901014543 1:6220582-6220604 GCTGGCCAGGTGCTAACCCCTGG - Exonic
902620164 1:17646122-17646144 GATGTGAAGGCGCCAGCACCCGG - Intronic
903420889 1:23217300-23217322 GGCGGGCAGGTGCGCACACCCGG + Intergenic
903470076 1:23580696-23580718 GACAGGCAGGTGCCAACCCCAGG - Intergenic
903659059 1:24965849-24965871 GATGCGCAGGTGGCAACAAGAGG - Intergenic
906416111 1:45622326-45622348 GAAGGGCAGGTGCCACCTCAGGG - Exonic
906842018 1:49149058-49149080 GATGGGCAAGAGCCAATGCCTGG - Intronic
907285303 1:53376139-53376161 GATGAGCAGCTGCCAGCAGCCGG + Intergenic
907987111 1:59542970-59542992 GGTGGGCAGGTGTCAAGAGCAGG + Intronic
908434124 1:64088374-64088396 GATAGGCAGATGACAAAACCAGG + Intronic
910054940 1:83022467-83022489 TATAGGCACATGCCAACACCTGG + Intergenic
910485427 1:87708234-87708256 GCTGGGCCGCTGCCAACACTAGG - Intergenic
913978504 1:143487272-143487294 GGTGAGCAGGTGGCAAAACCAGG + Intergenic
914072915 1:144312920-144312942 GGTGAGCAGGTGGCAAAACCAGG + Intergenic
914106239 1:144653440-144653462 GGTGAGCAGGTGGCAAAACCAGG - Intergenic
916676568 1:167068861-167068883 GGTGGGCAGGTGGCAGCACAGGG - Intronic
918793517 1:188860945-188860967 GCTGAGCAAATGCCAACACCAGG - Intergenic
920388255 1:205582803-205582825 CATAGGGAGGTGCCAACACAGGG + Intronic
1063311415 10:4956244-4956266 GATGGGCAGGTGCACAGGCCAGG + Intronic
1063316382 10:5010224-5010246 GATGGGCAGGTGCACAGGCCAGG - Intronic
1064024579 10:11837002-11837024 GATGGGCAGGTGGGGACTCCGGG - Intronic
1067676574 10:48384772-48384794 GTTGGCCAGGTGCCAAGTCCAGG + Intronic
1069058841 10:63872415-63872437 GAAGAGCAGGTTCCAACTCCTGG - Intergenic
1069191344 10:65494947-65494969 GAGGGGCAGGTACCAATACAGGG + Intergenic
1072002519 10:91210622-91210644 CATGGCTGGGTGCCAACACCTGG + Intronic
1075467811 10:122664684-122664706 GCTGGGCAGGTTCCATGACCAGG + Intergenic
1077359460 11:2134271-2134293 AAAGGGCAGGTGCCATCAGCCGG + Intronic
1078869147 11:15327884-15327906 GATGGGCTGGTGCCACCCCATGG - Intergenic
1079602230 11:22323807-22323829 GATGGGCAGGTGCCTGGACCTGG + Intergenic
1080424125 11:32140456-32140478 GAAGGGCAGAGGCCAACAGCAGG - Intergenic
1081462782 11:43287019-43287041 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1082819751 11:57537085-57537107 GTAGGGCAGCTGCCAACACAGGG - Intergenic
1082862975 11:57873081-57873103 GATGGGGAAGTGCGATCACCTGG + Intergenic
1083164501 11:60875218-60875240 TATGGGCAGGAGCCCACACTTGG + Exonic
1084486286 11:69450186-69450208 GATGGGCAGGTGAGGACACTGGG + Intergenic
1084519217 11:69653191-69653213 GAAGGGGCGGTGCCCACACCGGG + Exonic
1084749598 11:71195842-71195864 GGCAGGCAGGTACCAACACCAGG - Intronic
1084792678 11:71484515-71484537 GATGTGCAGGTGCCCCCACCTGG + Intronic
1089095495 11:115916712-115916734 CTGGGGCAGGTGCCAGCACCTGG + Intergenic
1089755725 11:120685167-120685189 GAGAGGGAGGTGTCAACACCTGG - Intronic
1090734378 11:129598525-129598547 GAGGGGCAGCAGCCAACACTGGG + Intergenic
1093413707 12:18896174-18896196 GAGGGGCAGCAGCCAACACTGGG - Intergenic
1096501991 12:52069907-52069929 GCTGGGCAGGTGCCCCCTCCGGG + Intronic
1102570091 12:113822282-113822304 GAAGGGCCTGTGCCAGCACCAGG - Intronic
1102978043 12:117220622-117220644 AATGTGCAGGTGTTAACACCCGG - Intronic
1105220824 13:18324123-18324145 GGTGAGCAGGTGGCAAAACCAGG - Intergenic
1106823358 13:33490921-33490943 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1109307954 13:60661666-60661688 GAGGGGCAGTAGCCAACACTGGG - Intergenic
1110567183 13:76968234-76968256 GAGGGGCAGCAGCCAACACTGGG - Intergenic
1111305664 13:86409778-86409800 GAGGGGCAGCAGCCAACACTGGG + Intergenic
1111900966 13:94199416-94199438 GATGGGGAGGTGCAAGCAGCTGG - Intronic
1119714017 14:76845385-76845407 GAGGGGCAGCAGCAAACACCTGG + Intronic
1122444285 14:101758024-101758046 GCTGAGCAGATGCTAACACCAGG - Intergenic
1122854269 14:104552592-104552614 GGTGGGCAGGTGCCAACCTCGGG + Intronic
1124687663 15:31796324-31796346 GATGGGCAGGTTGGAACCCCAGG + Intronic
1126343381 15:47667915-47667937 CTTGGGCAGGTGCCAAGAACAGG + Intronic
1128329718 15:66747538-66747560 GATGGGGTGGTGCCAATGCCAGG - Intronic
1129421409 15:75430261-75430283 GAGGGGCAGGGGCAAGCACCCGG + Exonic
1129466944 15:75729458-75729480 GATGGGCAGATGCAAAGCCCAGG - Intergenic
1129479114 15:75808825-75808847 GATGGGAAGGTGCCATCCCAGGG + Intergenic
1129994277 15:79991161-79991183 TATGGGCAGGAGCCAGCAGCTGG - Intergenic
1130108891 15:80949081-80949103 TAGGGGCAGGTGGCAGCACCAGG - Exonic
1130585326 15:85176138-85176160 GATGGTGAAGTGCCACCACCTGG - Intergenic
1130879775 15:88045029-88045051 GATGGGCAGGTGCCAACACCTGG - Intronic
1132799492 16:1744618-1744640 TATGGGCAGGTCCCAGCTCCAGG - Intronic
1133304239 16:4799924-4799946 GATGGGCATCTGGCATCACCTGG + Intronic
1133780618 16:8936241-8936263 GATACGCATGGGCCAACACCTGG + Intronic
1139655009 16:68382256-68382278 GAGGGGCAGGAGGCAACACTGGG + Intronic
1140745516 16:77977064-77977086 GAGGGGCAGGTGCCCACAAGAGG - Intronic
1141340472 16:83199354-83199376 GCTGGTCAGATGCCAACTCCTGG - Intronic
1142549155 17:727497-727519 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549206 17:727695-727717 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549240 17:727827-727849 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1142549274 17:727959-727981 AATAGGCAGGAGCCAACTCCGGG + Intergenic
1143358176 17:6346548-6346570 GATGGGCTGCTGCCAGCACCTGG - Intergenic
1143580448 17:7822449-7822471 GATGGCCAGGTGCACACGCCGGG - Intronic
1143679817 17:8467849-8467871 GGTGGGCCGGTGCCAGCTCCGGG + Exonic
1148148421 17:45380704-45380726 GAACGGCATGTGCAAACACCTGG + Intergenic
1149857558 17:60096132-60096154 CATTGGCAGCAGCCAACACCAGG + Intergenic
1150441143 17:65192471-65192493 CACGGGCATGTGCCACCACCTGG - Intronic
1152012094 17:77724968-77724990 GCTGGACAGGCGCCCACACCTGG - Intergenic
1152016718 17:77755862-77755884 GAAGGGCTGGTGCCAAGGCCGGG - Intergenic
1152359115 17:79822219-79822241 GATGGGCAAATGTCAACAACTGG - Intergenic
1155671649 18:28378718-28378740 GATGGTTATGTGCCAGCACCTGG - Intergenic
1155796356 18:30042902-30042924 GATTTGCAATTGCCAACACCTGG - Intergenic
1157358939 18:46961177-46961199 GATGGCCTGGAGCCACCACCTGG - Intronic
1157705620 18:49803204-49803226 GATGGCCTGGTGCCACCACCCGG + Intronic
1160069337 18:75611710-75611732 GCTGTCCAGGTGCCAAAACCCGG - Intergenic
1160388379 18:78512003-78512025 CATGTGCAGCTGCCACCACCAGG + Intergenic
1161714876 19:5869926-5869948 TATAGGCATGTGCCAGCACCTGG - Intronic
1163655708 19:18543653-18543675 AAGGGGGAGGTGCCAACGCCCGG - Exonic
1164889188 19:31808445-31808467 TATGGGCAGATTCCAGCACCAGG + Intergenic
1165324501 19:35106424-35106446 GGGGGGCAGGTACCACCACCCGG + Intergenic
1166427521 19:42692780-42692802 CATGGGCAGAAGCCACCACCTGG + Intronic
1166752439 19:45170734-45170756 GACTGGCAGGTGGCAACAGCTGG + Intronic
1168144732 19:54414666-54414688 GATGGGGAAGTGCCAACCCTGGG - Intergenic
925044376 2:760715-760737 GATGGGCAGGCCCCAGCCCCAGG + Intergenic
925317600 2:2937804-2937826 CCAGGGCAGGTGCCACCACCTGG + Intergenic
927194530 2:20538580-20538602 CATGGGCTGGTGCCACCAGCTGG - Intergenic
927808179 2:26166605-26166627 TATAGGCAGGTACCACCACCTGG + Intergenic
928101132 2:28437997-28438019 TATGGGCAGGTGGCCCCACCAGG + Intergenic
928217566 2:29374988-29375010 CCTGGGGAGGTGCCACCACCTGG - Intronic
931736551 2:65199607-65199629 GCTGTCCAGGGGCCAACACCTGG - Intergenic
932439000 2:71719983-71720005 GAGGGGCAGGCAGCAACACCAGG - Intergenic
934183231 2:89648353-89648375 GGTGAGCAGGTGGCAAAACCAGG + Intergenic
934235198 2:90225565-90225587 GATATGGAGGTGCAAACACCAGG + Intergenic
934293511 2:91722523-91722545 GGTGAGCAGGTGGCAAAACCAGG + Intergenic
935677104 2:105604604-105604626 GAAGCTCAGGTCCCAACACCAGG + Intergenic
936243503 2:110807567-110807589 GCAGGGCAGGTGCTAACTCCGGG - Intronic
938332173 2:130455590-130455612 GATGGCCAGGTTCCAACAGCCGG - Intergenic
939376446 2:141374959-141374981 GATGTGCAGATGTCAACACAAGG - Intronic
948059842 2:235034614-235034636 GAAGAGCAGGTGCAAACAGCCGG + Intronic
948108562 2:235435367-235435389 CACAGGAAGGTGCCAACACCAGG - Intergenic
1170777440 20:19390297-19390319 AATGGGCAGATACCAACACATGG - Intronic
1172978791 20:38926054-38926076 GAGAGGCAGGTGCCGACTCCCGG - Intergenic
1175191632 20:57215675-57215697 GATGGGCAGCTGCCTGCATCTGG + Intronic
1175665016 20:60851299-60851321 GATGATCAGGTGCCACCCCCAGG + Intergenic
1175898557 20:62351017-62351039 AATGTGCCGGTGCCAGCACCAGG + Intronic
1176044849 20:63087247-63087269 GATTGCCAAGTGCAAACACCGGG + Intergenic
1179925888 21:44533845-44533867 GCTGGGCAGGTGACAACCGCAGG + Exonic
1181419227 22:22786181-22786203 GATGAGCCAGTGCCAGCACCAGG - Intronic
1181468870 22:23125966-23125988 GATGGGGCGGTGACAGCACCAGG - Intronic
1181949838 22:26545934-26545956 TATAGGCAGGTACCATCACCTGG - Intronic
1183231855 22:36587412-36587434 GAAGGGCAGGGCCCACCACCAGG + Intronic
1184522493 22:45003375-45003397 GAGGGGCAGCTGCAGACACCTGG - Intronic
1185049997 22:48549268-48549290 GATGAGCAGGTATCAACATCAGG - Intronic
1185329869 22:50247678-50247700 GATGGGCAGGTGGGAGCACCTGG - Exonic
949336705 3:2982706-2982728 GATGGGCAGGGACCCAGACCTGG - Intronic
950893431 3:16425946-16425968 GAGGGGCAGCTGCCAGCAACGGG + Intronic
956541488 3:70344698-70344720 GATGGGCAGGTGCAGGAACCAGG - Intergenic
957447297 3:80330213-80330235 GCTGAGCAGGTGCCAGCACCAGG + Intergenic
964007800 3:151852223-151852245 GAGGGGCAGCAGCCAACACTGGG - Intergenic
967932023 3:194696857-194696879 GTTGGACACGTGCCAAGACCTGG - Intergenic
968276077 3:197441401-197441423 GATGGGTATGTGCAAAGACCTGG - Intergenic
968904606 4:3445571-3445593 GCTGGGCAGGTGCCACCCCGAGG - Intronic
968976584 4:3825227-3825249 GAGGAGCAAGTGCCAAGACCCGG - Intergenic
973871692 4:55172806-55172828 AATAGGCAGGGGCCAAGACCAGG - Intergenic
974760326 4:66266240-66266262 GAGGGGCAGCTGCCAGCACTGGG + Intergenic
974962779 4:68724547-68724569 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
978033895 4:103971658-103971680 GGTGGTCAGGTGCTAACACACGG - Intergenic
979978376 4:127224752-127224774 GAGGGGCAGGAGCCAGCACAGGG - Intergenic
980392957 4:132169827-132169849 GAGGGGCAGGAGCCAGCACGGGG - Intergenic
981407428 4:144387361-144387383 GATGGGGAGGTGGGAACACAAGG - Intergenic
982620954 4:157704092-157704114 GATGGGGTGGTGCAAACACAGGG + Intergenic
983670932 4:170237088-170237110 TATAGGCACGTGCCACCACCCGG - Intergenic
983921739 4:173353293-173353315 GATGTGCAGAGGCCAACCCCAGG + Intergenic
985030870 4:185787991-185788013 AATGGGCAGGTGACATCACATGG + Intronic
985542821 5:494687-494709 GGTGGGCAGGCGCCGGCACCGGG - Intronic
988307320 5:29509348-29509370 GAGAGGCATGTGCCAACTCCGGG - Intergenic
992992442 5:82298155-82298177 GATGGGCAGGTGCAGGAACCAGG + Intronic
995685384 5:114766536-114766558 GAAGGGCAGCAGCCAACACTGGG - Intergenic
997020523 5:129995371-129995393 GATGTGCAGAGGCCAACCCCAGG - Intronic
999353974 5:150906120-150906142 GGTGTGCAGGTGGCAAAACCAGG + Intergenic
999457617 5:151730844-151730866 TACAGGCAGGTGCCACCACCTGG + Intergenic
999672288 5:153968635-153968657 CATGGATAGGTGCCAAAACCAGG + Intergenic
1000384152 5:160657898-160657920 TATGGGCAGGTGCCATCAGATGG + Intronic
1006625077 6:35392131-35392153 CATGGGCCAGTGCCAGCACCAGG + Intronic
1010503736 6:76631777-76631799 GATGGGCAGGTGCAGAGGCCTGG + Intergenic
1011495415 6:87932527-87932549 GATAGGCAGCTGCAAGCACCTGG - Intergenic
1011835656 6:91427926-91427948 AATGAACAGATGCCAACACCAGG + Intergenic
1012039884 6:94190601-94190623 GATGGCCAAGTCCCTACACCTGG + Intergenic
1012820563 6:104081131-104081153 GATGGTCGAGTGCCAACACTTGG - Intergenic
1014992867 6:128103513-128103535 GATGGGCAGGTGCAGGAACCAGG - Intronic
1015042917 6:128743086-128743108 GACGGGCAGGTGCAAGCACCAGG - Intergenic
1017385595 6:153879141-153879163 AATAGGCAGGTGCCACCCCCAGG + Intergenic
1017948551 6:159116488-159116510 GATGGGCAGGTGCAGAGGCCAGG - Intergenic
1018952956 6:168391071-168391093 GATGGGCAGGTCCTGAGACCCGG + Intergenic
1023674537 7:42616315-42616337 GATTGGGAGGGGCCAGCACCTGG + Intergenic
1023759733 7:43453457-43453479 GATGGGAAGGATCCAACACTTGG + Intronic
1025946021 7:66105212-66105234 TATAGGCACGTGCCAACAACCGG - Intronic
1027128223 7:75572547-75572569 GACTGGCAGCTGCCATCACCAGG - Intronic
1028459147 7:91071716-91071738 GAGGGGCAGCAGCCAACACTGGG + Intronic
1029735009 7:102460774-102460796 GATAGGCACGGGCCAACCCCTGG - Intronic
1032265890 7:130369710-130369732 GATGGCCAAGAGCCAACCCCTGG + Intergenic
1034707468 7:153158460-153158482 GATGAGCAGGTGCCATCCCCAGG + Intergenic
1035245491 7:157559994-157560016 GATGGGCTGGTGCCAGCACCCGG + Intronic
1035490577 7:159272940-159272962 GATGGGCAGGTGCACAGGCCAGG - Intergenic
1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG + Intronic
1040508809 8:48075534-48075556 GCAGGGCATGTGCCAATACCTGG - Intergenic
1042629927 8:70805459-70805481 GAAGGGCAGAAGCCAGCACCGGG + Intergenic
1043443427 8:80297176-80297198 GGTGGGCAGGTGCCAGGCCCTGG - Intergenic
1048539979 8:135333664-135333686 GAGGGGCAGGCGACAACAGCAGG - Intergenic
1048960729 8:139574629-139574651 CATAGGGAGGTGCCATCACCAGG - Intergenic
1050030318 9:1379014-1379036 GATGGGCAAGTGCCACCACTTGG - Intergenic
1052716927 9:32128703-32128725 GAGGGGCAGCAGCCAACACTAGG + Intergenic
1053752451 9:41269727-41269749 CTTGGGCAGGTGGCACCACCAGG - Intergenic
1056301735 9:85249326-85249348 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
1057493304 9:95539826-95539848 GAAGGGCAGATGCCAGCAGCTGG - Intergenic
1058377473 9:104339881-104339903 CATGGGCAGGCCACAACACCAGG + Intergenic
1060321147 9:122562271-122562293 GAGGGGCAGCAGCCAACACTGGG - Intergenic
1061009651 9:127947482-127947504 GCTGGGCAGGTGCCCACATGTGG + Intronic
1061093232 9:128438850-128438872 GCTGGGTTGGGGCCAACACCAGG + Intergenic
1061211261 9:129194736-129194758 GGTGGGCATGTGGCAGCACCAGG - Intergenic
1061312767 9:129774917-129774939 GATGGGCAGGGGTGAGCACCTGG + Intergenic
1061836539 9:133333343-133333365 GGTGGGTAGGGGCCAACACAGGG + Intronic
1062428867 9:136518119-136518141 GCTGGGTAGGTGCCAGCACAGGG - Exonic
1062525147 9:136975218-136975240 GCTGGGCAGTTGCCAGCTCCTGG - Intergenic
1186116057 X:6306386-6306408 GAAAGACAGGTGCCAAAACCGGG + Intergenic
1187567033 X:20461003-20461025 GATGGGCAGTTGCCAGCATTTGG - Intergenic
1192001296 X:67154696-67154718 GATGGGCAGGTGCAGAGGCCAGG + Intergenic
1192951913 X:76026316-76026338 GAGGGGCAGGAGCCAATACTGGG + Intergenic
1198756018 X:139983419-139983441 GAAGGGCAGGTGGCTTCACCAGG + Intergenic
1199567408 X:149230156-149230178 GAGGGGCAGAAGCCAACACCAGG - Intergenic
1199810157 X:151340948-151340970 GTTTCTCAGGTGCCAACACCTGG + Intergenic
1200132498 X:153858585-153858607 GATAGGCAGGTGAAAAAACCAGG + Intergenic
1200255021 X:154576116-154576138 GCTGGGCAGATGCCAGCACTAGG + Intergenic
1200262748 X:154628288-154628310 GCTGGGCAGATGCCAGCACTAGG - Intergenic
1201705088 Y:16928209-16928231 GATCGGCAGGTCCCAACCCAAGG + Intergenic