ID: 1130879843

View in Genome Browser
Species Human (GRCh38)
Location 15:88045540-88045562
Sequence GGAAGTTCACAGCTTTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130879843_1130879847 16 Left 1130879843 15:88045540-88045562 CCTCTCCAAAGCTGTGAACTTCC 0: 1
1: 0
2: 1
3: 22
4: 186
Right 1130879847 15:88045579-88045601 ACCACAACAAAACACAAACTAGG 0: 1
1: 0
2: 9
3: 93
4: 841

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130879843 Original CRISPR GGAAGTTCACAGCTTTGGAG AGG (reversed) Intronic
900117818 1:1035973-1035995 GGAAGTGGTCAGCTTTGCAGAGG + Intronic
900684770 1:3941029-3941051 GGAGGTTCTGAGCTTTGGAGCGG - Intergenic
902880543 1:19369360-19369382 GAAACCTCACAGCTTTGGAGGGG - Intronic
903611486 1:24618010-24618032 GGAGGTTCATAGATTGGGAGTGG + Intergenic
903955417 1:27022085-27022107 GGAAGTTCACACCATTTGCGAGG + Intergenic
904846560 1:33423064-33423086 GGAAGTTCACAGCTCATGAGTGG + Intronic
907990084 1:59572351-59572373 GGAAATTGGCAGCTTTGGTGTGG + Intronic
909492252 1:76238646-76238668 GGAAGGAACCAGCTTTGGAGAGG + Intronic
910132529 1:83925540-83925562 AGAAGTTTTCAGCCTTGGAGAGG + Intronic
911493668 1:98602335-98602357 GAAAATTCACACCATTGGAGAGG + Intergenic
912497120 1:110098767-110098789 GGAAGTACCCAGCATTGGGGAGG + Intergenic
912964779 1:114228063-114228085 GGAAGGTCTCAGGGTTGGAGTGG - Intergenic
913062464 1:115220745-115220767 GGAATTTCACAGGATTGGACCGG - Intergenic
913663619 1:121027906-121027928 GGAATTTCACTGCTGTGGAAAGG - Intergenic
914202996 1:145503118-145503140 GGAATTTCATAGCATTGGTGTGG - Intergenic
914236926 1:145821052-145821074 GGAATTTCATAGCATTGGTGTGG - Intronic
914482118 1:148076269-148076291 GGAATTTCATAGCATTGGTGTGG - Intergenic
915235860 1:154481218-154481240 GGGAGTTCACAGCTGTGTGGTGG - Exonic
916462411 1:165040220-165040242 GGAAGTACACTCCTTTAGAGTGG + Intergenic
916929001 1:169555082-169555104 GTAAGTTCACAGCTCTCAAGGGG - Intronic
918468007 1:184841538-184841560 GGAATCTCACAGCCTTGGAAAGG + Intronic
918523222 1:185437891-185437913 GGGATTTCACAGCTTCAGAGTGG + Intergenic
919433255 1:197523510-197523532 AGATGTTAACTGCTTTGGAGGGG + Intronic
921036410 1:211383088-211383110 GGAAACTCAGAGCTTGGGAGCGG - Intergenic
921935825 1:220795986-220796008 TGAATTTCACAGCTATGGAGAGG - Intronic
922150308 1:222996705-222996727 GAAAGTTCACATCTTTGGTCAGG + Intronic
922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG + Intergenic
923541697 1:234892925-234892947 GGAATTTCCCAGCTCTGGGGTGG - Intergenic
1064457901 10:15505580-15505602 GGAAATGTAGAGCTTTGGAGAGG - Intergenic
1065169512 10:23012434-23012456 GAAGGGTCTCAGCTTTGGAGTGG - Intronic
1067461557 10:46462053-46462075 GGAACTCCAGAGCCTTGGAGTGG + Exonic
1067625637 10:47922548-47922570 GGAACTCCAGAGCCTTGGAGTGG - Intergenic
1067785263 10:49241213-49241235 GGCAGCTGACAGCTCTGGAGTGG + Intergenic
1070361701 10:75696705-75696727 TCAAGTTCATAGCATTGGAGAGG + Intronic
1070440854 10:76441704-76441726 GGAGGTACACAGCTGGGGAGAGG - Intronic
1073609141 10:104926094-104926116 GGCAGCTCACAGCTCAGGAGGGG - Intronic
1074003884 10:109399478-109399500 GGAGCTGCCCAGCTTTGGAGAGG - Intergenic
1075803640 10:125169560-125169582 GGTAGTTCTCAGCTGTGGAGTGG + Intergenic
1077144193 11:1037410-1037432 GGAAGAAAACAGCTGTGGAGGGG - Intergenic
1077329311 11:1977007-1977029 GGGAGTTCAGAGCTTAGGAGGGG - Intronic
1078652438 11:13208103-13208125 GGGAGTTCACAGTTTAGTAGGGG - Intergenic
1078720608 11:13880373-13880395 GGAAGTTGGCAGCTTGGGAGGGG - Intergenic
1079198266 11:18350749-18350771 TGAATTTCATAGCTTTGTAGAGG + Intronic
1083297671 11:61723942-61723964 GGAAGTTGACAGCTGTGTGGTGG - Intronic
1083379184 11:62250859-62250881 TGAAAGTCACTGCTTTGGAGTGG + Intergenic
1202812290 11_KI270721v1_random:32186-32208 GGGAGTTCAGAGCTTAGGAGGGG - Intergenic
1092501874 12:9055957-9055979 AGAACTATACAGCTTTGGAGAGG - Intergenic
1095171066 12:39037160-39037182 GGAAGTTTGCAGCTTAGGTGTGG - Intergenic
1098227740 12:68342107-68342129 GGTAGTTCCCAGCCTTGGACAGG + Intergenic
1099825954 12:87778466-87778488 GGACGCAAACAGCTTTGGAGGGG + Intergenic
1100422712 12:94452992-94453014 GCAAGTTCAGATCTTTGTAGAGG + Intronic
1101381834 12:104220191-104220213 GGAAATTGAAAGCTTTGGAATGG + Intronic
1101861597 12:108486641-108486663 AGAAGATCACAGCTCTGGGGAGG + Intergenic
1102000728 12:109556599-109556621 GGTTGTTCACAGATTTGGAATGG - Exonic
1102027523 12:109722008-109722030 GAAAGTTCACAGCCTGGGACAGG + Intronic
1102466217 12:113132318-113132340 GGGAGTTCACAGTTTGGAAGTGG - Intronic
1102644716 12:114396507-114396529 GGACGTTCCCAGCTGGGGAGAGG - Intronic
1103059663 12:117848336-117848358 TGAAGTTCCCAGTTTTGGAATGG + Intronic
1106251706 13:27986949-27986971 TGAAGTCCTCAGCTATGGAGAGG + Intronic
1110008967 13:70307378-70307400 GGAATATCACATCTTTGGAGAGG - Intergenic
1110639721 13:77808710-77808732 GGAATATCAGGGCTTTGGAGTGG + Intergenic
1112508294 13:99988604-99988626 GGAAGATCACAGCCTGGGAGTGG + Intergenic
1112969646 13:105244831-105244853 TGATGTTGACAGCTTTGAAGTGG - Intergenic
1113679369 13:112232327-112232349 GGGAATTCACAGCTTTCCAGTGG + Intergenic
1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG + Intergenic
1115437015 14:33386765-33386787 GGAAGTTCACAGATTTTGCAAGG + Intronic
1117815220 14:59590833-59590855 GGAAGTGTAGAGCTTTGGAGAGG + Intergenic
1118316580 14:64729611-64729633 GAAAGTGCACTGCTCTGGAGGGG + Intronic
1119784362 14:77301322-77301344 GGCAGTTCTCAGACTTGGAGCGG + Intronic
1121692740 14:95889533-95889555 GAAAGTTCACAGCCTAGGAGAGG - Intergenic
1121843125 14:97151098-97151120 GGATGCACACAGCTGTGGAGTGG + Intergenic
1121846833 14:97179559-97179581 GGACGTGGACATCTTTGGAGGGG + Intergenic
1121953554 14:98193807-98193829 GATAGTTCAAGGCTTTGGAGAGG - Intergenic
1126523548 15:49623561-49623583 GGAAGTTCCAAGCTTGGGAAGGG - Intronic
1130367955 15:83257570-83257592 GGAGGTGCACAGTTTTGTAGTGG + Exonic
1130879843 15:88045540-88045562 GGAAGTTCACAGCTTTGGAGAGG - Intronic
1131376793 15:91931364-91931386 CGAGGTTCACAGCTGAGGAGAGG + Intronic
1137538634 16:49346733-49346755 GCAATTTCTCAGCTTTGGAGAGG - Intergenic
1139281108 16:65771283-65771305 GAAAGTTCTCCGCTGTGGAGAGG - Intergenic
1140019191 16:71221140-71221162 GAAAGTGTACACCTTTGGAGTGG - Intronic
1143163727 17:4887144-4887166 GGAAGATGACAGCCATGGAGAGG + Exonic
1143460751 17:7101938-7101960 AGAAGAGCACAGCTTTGGAGGGG + Intronic
1143808639 17:9452516-9452538 GGAAGTGCCCAGCTTTGGGATGG + Intronic
1146370809 17:32264976-32264998 GGAAGGGCACAGCCTTGGTGTGG + Intergenic
1148555010 17:48573317-48573339 GGAATGTTCCAGCTTTGGAGCGG - Intronic
1148564937 17:48627045-48627067 GGACGTTGTCCGCTTTGGAGGGG + Intronic
1149427137 17:56566060-56566082 CAAAGTTGACAGCTTTTGAGTGG - Intergenic
1152221970 17:79073848-79073870 GGAAGCTCCTAGCTGTGGAGGGG + Intergenic
1155967780 18:32052091-32052113 GGAAATTAACTGCTATGGAGAGG - Intronic
1157133501 18:45031340-45031362 CGATGTGGACAGCTTTGGAGGGG + Intronic
1157196717 18:45625802-45625824 GGTAGCCCACTGCTTTGGAGAGG - Exonic
1158044435 18:53138255-53138277 GGAAATTGACAGCATTAGAGAGG - Intronic
1158217677 18:55116856-55116878 GGAAGTTCCCAGTGATGGAGGGG + Intergenic
1158806076 18:60974833-60974855 TTAAGTTCACAGTTTTGGAACGG + Intergenic
1159030006 18:63221365-63221387 GGAATTTCACATCCTTGTAGTGG - Intronic
1163493818 19:17633025-17633047 GGGTGCTCACAGCCTTGGAGGGG + Intronic
1163762148 19:19143318-19143340 TGGAGTTCACAGATTTGGACAGG - Intergenic
1164388267 19:27794865-27794887 AAAAGGTCACAGCTTTGCAGGGG + Intergenic
1166245324 19:41521817-41521839 TAAAGGTGACAGCTTTGGAGGGG - Intergenic
1166522411 19:43489521-43489543 GGAAGTGAACAGCGTAGGAGGGG + Intronic
1167469528 19:49667649-49667671 AGGGGTTCACAGCTTGGGAGAGG + Intronic
925147484 2:1590938-1590960 GGAAGTCAACAGAGTTGGAGTGG + Intergenic
925261697 2:2534990-2535012 GGATGCTCACAGCTGAGGAGGGG + Intergenic
926630646 2:15133201-15133223 GGAAGTTCACAGCCTTGTGGAGG + Intergenic
927277603 2:21274896-21274918 GGAAGTTCGCAGCCTTTAAGGGG + Intergenic
928181363 2:29071115-29071137 GGAAGTTCGCCGCTTTGTGGTGG + Exonic
928236001 2:29541272-29541294 CCAAGTTGATAGCTTTGGAGAGG - Intronic
928238421 2:29565412-29565434 GGAAGCTCACAGTTATTGAGGGG + Intronic
929379910 2:41337313-41337335 GGATGTGAACATCTTTGGAGAGG - Intergenic
931255826 2:60571442-60571464 GTAATTTAACAGGTTTGGAGAGG + Intergenic
933973328 2:87488018-87488040 GGAAGTTCACAGTTTGGAAGGGG + Intergenic
934754414 2:96815890-96815912 GGAAGTTCCCGGCTTGGGAGCGG - Intergenic
935595212 2:104872721-104872743 GAAAGTTCACAGCCAAGGAGAGG + Intergenic
936270823 2:111047173-111047195 GGAAGTTGACTGGTTTGGATTGG + Intronic
936320394 2:111462192-111462214 GGAAGTTCACAGTTTGGAAGGGG - Intergenic
939215657 2:139235044-139235066 GTAAGTTCACAGCTTTTATGTGG - Intergenic
940089671 2:149901341-149901363 GGAAGTGCTCAGCTTTGAAAGGG + Intergenic
941312510 2:163951700-163951722 GGGATTTCACAGCATTGGACAGG + Intergenic
941430362 2:165407445-165407467 GGCTGTTCACATTTTTGGAGAGG - Intergenic
941612699 2:167681152-167681174 GCAAGCACACAGCTTGGGAGAGG + Intergenic
942221390 2:173772359-173772381 AGAAGTTCACAGGTGAGGAGAGG - Intergenic
942544525 2:177049261-177049283 GGAACTTCACATCTGAGGAGTGG + Intergenic
943077946 2:183220997-183221019 AGAAGTTGACATGTTTGGAGGGG + Intergenic
943623641 2:190176878-190176900 GTAAGTTCACTGTTTTGGAGAGG + Intronic
944452450 2:199856948-199856970 GTAACCTCAGAGCTTTGGAGAGG + Intergenic
944990549 2:205230374-205230396 GGAAACTCGCAGCTTTGAAGGGG - Intronic
946147981 2:217745076-217745098 GGAAGTTGACAGCATTTCAGTGG - Intronic
946465790 2:219910763-219910785 GGAAGTTCACTGACTTGCAGAGG + Intergenic
946873788 2:224108319-224108341 GGAAGTTCACGTGTTTGCAGAGG - Intergenic
947696799 2:232197531-232197553 GGAAGTTTTCAGGTTTGGATGGG + Intronic
1169185994 20:3617827-3617849 GGAAGTACACAGCATTGTACGGG + Intronic
1169579439 20:7002367-7002389 AAAAGTTGACAGGTTTGGAGGGG + Intergenic
1171172016 20:23023884-23023906 GGATGTTAACGGTTTTGGAGTGG - Intergenic
1172845918 20:37929935-37929957 GAAGGGTCACAGCTTTGAAGTGG + Intronic
1177518728 21:22189435-22189457 GAATGTTGACAGCGTTGGAGGGG - Intergenic
1180169798 21:46052109-46052131 GGCGGTTCAGATCTTTGGAGAGG - Intergenic
1183441187 22:37823971-37823993 GGAAGTTCACAGTGGAGGAGGGG - Intronic
949615421 3:5748458-5748480 GGCAGTCCATAGGTTTGGAGAGG + Intergenic
950399356 3:12758787-12758809 GGAACCTAACAGCTTAGGAGGGG - Intronic
951108309 3:18771132-18771154 TGAAATTCACCTCTTTGGAGAGG - Intergenic
952521929 3:34169530-34169552 GGAACTTCTGAGTTTTGGAGGGG + Intergenic
953082715 3:39635596-39635618 GGAACTTTATAGCTTTGTAGTGG - Intergenic
962047400 3:131775339-131775361 GGAAATTAACATCTTTGGTGGGG + Intronic
964097546 3:152950421-152950443 GGAATTTTACAGGTTTAGAGAGG - Intergenic
964119215 3:153164314-153164336 GGAAGTTCACAGGTTGGCACCGG - Exonic
964944631 3:162205110-162205132 GGATGTTCACAAGTTAGGAGAGG - Intergenic
967157469 3:186706515-186706537 GGAAGTTCACACCTCTGGCTGGG + Intergenic
967869171 3:194215546-194215568 GGAAGTTCACAGGTGAGGGGAGG + Intergenic
970520405 4:16878130-16878152 GGAAGTTCACAGATCAGCAGAGG + Intronic
970820336 4:20204825-20204847 TGAAGTTCACAAATTTGGAAAGG + Intergenic
975405050 4:73979840-73979862 GGGAGGACACAGCTTGGGAGAGG - Intergenic
976598096 4:86913193-86913215 GGAAGATCACAGCTGTGCTGTGG - Intronic
977376441 4:96211223-96211245 TGAATTTGACAGCTTTGGTGTGG - Intergenic
982256799 4:153458746-153458768 GGGATTTAACAGCTTTGGAAAGG + Intergenic
982816163 4:159887538-159887560 GTGATTTCACAGCTTTGGTGAGG - Intergenic
984840351 4:184062001-184062023 GGAAGTCCTCTGCTATGGAGAGG - Intergenic
985278470 4:188262545-188262567 GGAAGTCCACAGCCCTGGCGTGG + Intergenic
991525137 5:67547959-67547981 TGAAATTCTCAGCTTTTGAGAGG + Intergenic
994331287 5:98509365-98509387 GGTGGTTCACAGCTTGGTAGGGG + Intergenic
996325273 5:122266618-122266640 GGAGTTTCACAGATTTGGAGTGG + Intergenic
998591779 5:143486468-143486490 GGAAGATCACAGCCCAGGAGAGG + Intergenic
1001169846 5:169408827-169408849 GCATGTTCCCAGCTTTGCAGGGG - Intergenic
1002544644 5:179931881-179931903 GGAAGTTCACAGGTTGGCACTGG - Intronic
1002821460 6:729099-729121 GGAAATTCACATTTATGGAGAGG + Intergenic
1005626783 6:27669902-27669924 GGAAGGTGGCAGCTTTGGGGCGG - Intergenic
1007131933 6:39483334-39483356 GGAAAATCACAGTTGTGGAGAGG - Intronic
1010488638 6:76448364-76448386 AGAAGGTCAAAGCTATGGAGTGG + Intergenic
1011115714 6:83889286-83889308 GGAATTTCACAGCTAGAGAGGGG + Intronic
1011510071 6:88090366-88090388 GGAAGTTCATAAATTTGGAAAGG - Intergenic
1011938880 6:92817706-92817728 GGAAGCCCACTGTTTTGGAGGGG - Intergenic
1013857251 6:114588802-114588824 TGAACTCCACAGCTTTGCAGAGG + Intergenic
1014312744 6:119825433-119825455 AGAAGTCCACAGCTTAGCAGTGG - Intergenic
1014674713 6:124349295-124349317 GGAAGTTCCCGCCTTTGTAGGGG - Intronic
1016965310 6:149713198-149713220 AGAACTTCTCTGCTTTGGAGGGG - Intronic
1017675333 6:156807221-156807243 GAAAGTTCAGATCTATGGAGTGG + Intronic
1019001744 6:168759188-168759210 TGAAGTTCATAAATTTGGAGAGG - Intergenic
1020342051 7:7122439-7122461 GGAAGTTAACAGCTATGGAGTGG - Intergenic
1023896778 7:44440339-44440361 GGACGTTCACACTTTTGAAGAGG - Intronic
1025609722 7:63067824-63067846 ACAAGTTCAGAGCTTTGCAGGGG - Intergenic
1025639443 7:63353325-63353347 ACAAGGTCACAGCTTTGCAGGGG - Intergenic
1025643256 7:63394767-63394789 ACAAGGTCACAGCTTTGCAGGGG + Intergenic
1030830497 7:114213872-114213894 GCAAGTTCAGAGCTCTGGTGTGG - Intronic
1031372437 7:120984576-120984598 AGGAGTTCACATCTTTTGAGAGG - Intergenic
1032752243 7:134853031-134853053 GGAAGTTCACAGAGCTGGATGGG + Intronic
1032928827 7:136641166-136641188 GGAAGATCACAGAGTAGGAGGGG - Intergenic
1034803973 7:154072336-154072358 GGAAGGTCACACCTCTGGATAGG - Intronic
1035376342 7:158409353-158409375 GGCAGTCCTCAGCTTAGGAGAGG + Intronic
1035610917 8:963328-963350 AAAAGTTAGCAGCTTTGGAGTGG + Intergenic
1036292806 8:7509376-7509398 AGAAGTTCACAGCCTAGGAAGGG - Intergenic
1036329756 8:7811633-7811655 AGAAGTTCACAGCCTAGGAAGGG + Intergenic
1038098028 8:24337454-24337476 GGAAGTTTACAGATTTGCCGAGG - Intronic
1039635443 8:39159691-39159713 GAAATTTCACAGGGTTGGAGTGG - Intronic
1043072907 8:75661818-75661840 GGAAACTCACAGCCTTGTAGTGG + Intergenic
1044330987 8:90920217-90920239 GGAATATCACAGATTTGGGGTGG - Intronic
1046062962 8:109161401-109161423 CGGAGTTCACAGCATTGAAGAGG + Intergenic
1048152385 8:131906295-131906317 GGAAGTTCACAGCTCTTAGGAGG + Intronic
1050621774 9:7460938-7460960 GGAAGTTCACAGGTTGGCAATGG - Intergenic
1058117443 9:101100259-101100281 GGAAGATCTCACCTTTGGGGTGG + Intronic
1059263171 9:112999059-112999081 AGAAATTCTCTGCTTTGGAGTGG + Intergenic
1060060986 9:120459335-120459357 AGAAATTTACAGCTTTGGATAGG - Intronic
1061050708 9:128193060-128193082 GCCAGTCCAGAGCTTTGGAGCGG - Intronic
1189118719 X:38370615-38370637 GGAAGTTCACACCATTTGCGCGG + Intronic
1190415271 X:50174523-50174545 GGAACTTCACAGTTTAGAAGAGG + Intergenic
1193466302 X:81852142-81852164 GTAATTTGACAGATTTGGAGGGG + Intergenic
1194366506 X:93019775-93019797 GGCAGTGCACAGCTTGGGAGTGG + Intergenic
1197714752 X:129698699-129698721 GGAAGTTCACTGCTTAGTAAGGG - Intergenic
1199149138 X:144408632-144408654 GGTACTTCAGAGCTTTGGTGAGG - Intergenic
1199512757 X:148641076-148641098 GGAAATTCACAGCCCAGGAGAGG - Intronic
1199982903 X:152930638-152930660 GGCAGTTGACACCTTGGGAGGGG + Intronic
1200674734 Y:6136036-6136058 GGCAGTGCACAGCTTGGGAGTGG + Intergenic